Please tell me the code to play midi or wav file on a web site. Or a site where I can copy and add the code myself. Thanks
How do I write the code for a midi file to play music on a web site?
If you are simply using basic HTML on your website, then the format can be %26lt;BGSOUND SRC="YourMusicFileHere.wav" LOOP="1"%26gt; .... your music file should also be on the same folder as your html pages or you need to specify the location, the loop can also be manipulated depending on how many times you would want it to play. If you want to add music on a flash website, there are lots of methods how, here is one;
http://www.premiumbeat.com/flash_resourc...
Just follow the steps. They have provided the swf for the player already, you only need to upload you music files on your domain and direct in on the embed tag.
Sunday, August 2, 2009
How do I make or code an online machine translator?
I'd like to use one to make a 'code' my friends and I can decipher, Ie, our own 'language' that we can run through one. So, does anyone know how to program an online machine translator?
How do I make or code an online machine translator?
May be you can contact a web developer at website like http://definitivelab.com/ .
How do I make or code an online machine translator?
May be you can contact a web developer at website like http://definitivelab.com/ .
What is the default security code for a Nokia 2126 Tracfone?
A friend of mine just bought a Nokia 2126 Tracfone. He wants to restrict the calls on it but can't find the default security code. Does anyone know it?
What is the default security code for a Nokia 2126 Tracfone?
willowkarr@msn.com
Reply:1234, 0000, or the last 4 digits of your cell phone number are often the usual security codes
Reply:it should be the last digits of the phone number by default.
What is the default security code for a Nokia 2126 Tracfone?
willowkarr@msn.com
Reply:1234, 0000, or the last 4 digits of your cell phone number are often the usual security codes
Reply:it should be the last digits of the phone number by default.
What does this work dress code description mean?
The dress code for my new job is described as "somewhat casual but neat " what does this mean? I'm going to b e work in a bio lab if this helps?
What does this work dress code description mean?
I think it means no jeans, t-shirts, or athletic shoes even if they are new and clean. I think they mean chinos or khakis for trousers, a shirt with a collar (Polo shirt or sport shirt), leather casual shoes and dark socks. You can't go wrong with that to start. After a few weeks, you'll get a better feel for what they mean. Observe what the supervisors and star performers wear, and you probably won't go wrong.
Reply:I would take this to mean no jeans. If you're a guy, I'd wear nice pants like Dockers and a dress shirt or polo shirt. If you're a woman, I'd wear nice pants and casual tops, either button down or pullover -- no spaghetti straps or tank tops. Look professional, but not like you're about to step into a meeting.
Reply:Casual typically refers to slacks, such as Dockers or similar type pants. Button down blouses, not pull over T shirts that show the midriff. Comfortable shoes, not open toe sandals or heels.
Reply:With a description like that, I would start with casual dress pants like Dockers and a button down or polo-type shirt. If you notice people wearing jeans, then go with that. Neat would imply no stained, torn, ripped, or badly wrinkled clothing regardless of jeans or Dockers.
Reply:That sounds like dressy casual to me.
Guys: kacki pants and shirt. No tie.
girls: slacks and shirt with flats. No need for stockings or heels. No ragged bluejeans or middie shirts. No t-shirts with sayings.
Reply:It could mean jeans is good condition and no collared shirt, or nice pants and a collared shirt, or anything in between.
Best bet is to call HR and ask them. That's what they get paid for. :)
Reply:Means you don't need to wear a tie but a shirt will do.Also dress pant in cotton would be okay.Of course ,all dresses are required to be neat so don't wear the same thing without washing it.Since you work at a lab some sort of coat must be necessary for you to wear that's why casual wear will be comfortable rather than formal.
Reply:My guess would be to wear something along the line of Dockers.
Reply:casual as in you dont have to dress up too much you can wear normal clothes like pants or shorts but you cant come in wearing torn shorts and pants and stained shirts etc.
Reply:This means that you don't have to wear formal business clothes, but they should be in good condition, as should your body. Just make sure that you are clean, your hair has a neat appearance (and, if long, is tied back in a tight ponytail), and you aren't wearing stained shirts or torn jeans. In bio labs, there are sometimes dangerous chemicals or biohazards, and employers generally don't want much skin exposed. A nice, clean, long-sleeved shirt with long pants and closed-toed shoes is probably your best option.
Reply:A pair of Dockers or kakhi's and a nice shirt or sweater.
Reply:I think it means khakis, button shirts, loafers, etc.; no holes, no wrinkles. No t-shirts, shorts, or flip-flops. Just look at what others are wearing, you will get the idea very quickly.
Reply:it means that you could wear a sweater or a nice top with a descent pair of jeans
stamen
What does this work dress code description mean?
I think it means no jeans, t-shirts, or athletic shoes even if they are new and clean. I think they mean chinos or khakis for trousers, a shirt with a collar (Polo shirt or sport shirt), leather casual shoes and dark socks. You can't go wrong with that to start. After a few weeks, you'll get a better feel for what they mean. Observe what the supervisors and star performers wear, and you probably won't go wrong.
Reply:I would take this to mean no jeans. If you're a guy, I'd wear nice pants like Dockers and a dress shirt or polo shirt. If you're a woman, I'd wear nice pants and casual tops, either button down or pullover -- no spaghetti straps or tank tops. Look professional, but not like you're about to step into a meeting.
Reply:Casual typically refers to slacks, such as Dockers or similar type pants. Button down blouses, not pull over T shirts that show the midriff. Comfortable shoes, not open toe sandals or heels.
Reply:With a description like that, I would start with casual dress pants like Dockers and a button down or polo-type shirt. If you notice people wearing jeans, then go with that. Neat would imply no stained, torn, ripped, or badly wrinkled clothing regardless of jeans or Dockers.
Reply:That sounds like dressy casual to me.
Guys: kacki pants and shirt. No tie.
girls: slacks and shirt with flats. No need for stockings or heels. No ragged bluejeans or middie shirts. No t-shirts with sayings.
Reply:It could mean jeans is good condition and no collared shirt, or nice pants and a collared shirt, or anything in between.
Best bet is to call HR and ask them. That's what they get paid for. :)
Reply:Means you don't need to wear a tie but a shirt will do.Also dress pant in cotton would be okay.Of course ,all dresses are required to be neat so don't wear the same thing without washing it.Since you work at a lab some sort of coat must be necessary for you to wear that's why casual wear will be comfortable rather than formal.
Reply:My guess would be to wear something along the line of Dockers.
Reply:casual as in you dont have to dress up too much you can wear normal clothes like pants or shorts but you cant come in wearing torn shorts and pants and stained shirts etc.
Reply:This means that you don't have to wear formal business clothes, but they should be in good condition, as should your body. Just make sure that you are clean, your hair has a neat appearance (and, if long, is tied back in a tight ponytail), and you aren't wearing stained shirts or torn jeans. In bio labs, there are sometimes dangerous chemicals or biohazards, and employers generally don't want much skin exposed. A nice, clean, long-sleeved shirt with long pants and closed-toed shoes is probably your best option.
Reply:A pair of Dockers or kakhi's and a nice shirt or sweater.
Reply:I think it means khakis, button shirts, loafers, etc.; no holes, no wrinkles. No t-shirts, shorts, or flip-flops. Just look at what others are wearing, you will get the idea very quickly.
Reply:it means that you could wear a sweater or a nice top with a descent pair of jeans
stamen
Does anybody know a promotion code for Spaceslide?
I am looking to order some wardrobe fittings from them and notice they have a place for a Promotional Discount Code. Can you help?
Does anybody know a promotion code for Spaceslide?
what your asking for seems dishonest.
sincerely,
your conscience
Reply:Dishonest? it is the company themselves who've provided a space for a promotional code. I think it shows initiative! If anybody has a code it would be much appreciated by me as well as the slug.
Does anybody know a promotion code for Spaceslide?
what your asking for seems dishonest.
sincerely,
your conscience
Reply:Dishonest? it is the company themselves who've provided a space for a promotional code. I think it shows initiative! If anybody has a code it would be much appreciated by me as well as the slug.
What is a good motto for a Knight who is honored the code of chivalry?
What is a good motto for a Knight who is honored the code of chivalry? I need this because i have to do a project and i need to turn it in by next friday and i need a motto.
What is a good motto for a Knight who is honored the code of chivalry?
Deus vult! - God wills it! (Slogan of the Crusades)
Fabricati diem - Make my day
Custos morum - Guardian of morals
amor patriae - Love of country
volens et valens - wiilling and valiant)
acta non verba - Action not words
Facta, non verba - Deeds, not words. (Actions speak louder than words)
Decrevi - I have decreed
audio, video, disco - I hear, I see, I learn
vincere aut mori - conquer or die
Carpe Cerevisi - Seize the beer!
Carpe diem - Seize the day. (opportunity) (Horace)
Reply:Below I found a good website that quotes knight sayings. I liked this one.
You who long for the Knightly Order,
It is fitting you should lead a new life;
Devoutly keeping watch in prayer,
Fleeing from sin, pride and villainy;
The Church defending,
The Widows and Orphans succouring.
Be bold and protect the people,
Be loyal and valiant, taking nothing from others.
Thus should a Knight rule himself.
He should be humble of heart and always work,
And follow Deeds of Chivalry.;
Be loyal in war and travel greatly;
He should frequent tourneys and joust for his Lady Love;
He must keep honor with all,
So that he cannot be held to blame.
No cowardice should be found in his doings,
Above all, he should uphold the weak,
Thus should a Knight rule himself.
— Eustace Deschamps
Check it out
Reply:All of these are vows of the knights, and the code...any variation would do well as a motto:
To fear God and maintain His Church
To serve the liege lord in valor and faith
To protect the weak and defenseless
To give succor to widows and orphans
To refrain from the wanton giving of offense
To live by Honor and for glory
To despise pecuniary reward
To fight for the welfare of all
To obey those placed in authority
To guard the Honor of fellow knights
To eschew unfairness, meanness and deceit
To keep faith
At all times to speak the truth
To persevere to the end in any enterprise begun
To respect the Honor of women
Never to refuse a challenge from an equal
Never to turn the back upon a foe
What is a good motto for a Knight who is honored the code of chivalry?
Deus vult! - God wills it! (Slogan of the Crusades)
Fabricati diem - Make my day
Custos morum - Guardian of morals
amor patriae - Love of country
volens et valens - wiilling and valiant)
acta non verba - Action not words
Facta, non verba - Deeds, not words. (Actions speak louder than words)
Decrevi - I have decreed
audio, video, disco - I hear, I see, I learn
vincere aut mori - conquer or die
Carpe Cerevisi - Seize the beer!
Carpe diem - Seize the day. (opportunity) (Horace)
Reply:Below I found a good website that quotes knight sayings. I liked this one.
You who long for the Knightly Order,
It is fitting you should lead a new life;
Devoutly keeping watch in prayer,
Fleeing from sin, pride and villainy;
The Church defending,
The Widows and Orphans succouring.
Be bold and protect the people,
Be loyal and valiant, taking nothing from others.
Thus should a Knight rule himself.
He should be humble of heart and always work,
And follow Deeds of Chivalry.;
Be loyal in war and travel greatly;
He should frequent tourneys and joust for his Lady Love;
He must keep honor with all,
So that he cannot be held to blame.
No cowardice should be found in his doings,
Above all, he should uphold the weak,
Thus should a Knight rule himself.
— Eustace Deschamps
Check it out
Reply:All of these are vows of the knights, and the code...any variation would do well as a motto:
To fear God and maintain His Church
To serve the liege lord in valor and faith
To protect the weak and defenseless
To give succor to widows and orphans
To refrain from the wanton giving of offense
To live by Honor and for glory
To despise pecuniary reward
To fight for the welfare of all
To obey those placed in authority
To guard the Honor of fellow knights
To eschew unfairness, meanness and deceit
To keep faith
At all times to speak the truth
To persevere to the end in any enterprise begun
To respect the Honor of women
Never to refuse a challenge from an equal
Never to turn the back upon a foe
Is 190 proof Nirvana, and will having it (nirvana) get the zip code to it?
I know someone (well I do NOT know them, I running for office, so you know how it is, they are a good friend of mine, heeeheee)
and they need the zip code to Nirvana, I say 190 Proof will get you it, (gotta get those votes ya know),
WILL IT?
Thank you for your support!
(now answer the question please!)
Is 190 proof Nirvana, and will having it (nirvana) get the zip code to it?
http://www.nirvanaclub.com/index.php?sc=...
I am confused also my dear, I just saw your lovely avatar and just had to say hello, my beauty.
I hope the link help.
Perhaps, it is just so nice to see you today.
Reply:I am so confused!!
Reply:Nirvana is a mythological place of ecstasy my lovely.
and they need the zip code to Nirvana, I say 190 Proof will get you it, (gotta get those votes ya know),
WILL IT?
Thank you for your support!
(now answer the question please!)
Is 190 proof Nirvana, and will having it (nirvana) get the zip code to it?
http://www.nirvanaclub.com/index.php?sc=...
I am confused also my dear, I just saw your lovely avatar and just had to say hello, my beauty.
I hope the link help.
Perhaps, it is just so nice to see you today.
Reply:I am so confused!!
Reply:Nirvana is a mythological place of ecstasy my lovely.
How can I make my own telephone area code?
I am making a fake country and need an area code for my capital city how do I get an area code for myself that is actually functional for me.
How can I make my own telephone area code?
You can't.
sim cards
How can I make my own telephone area code?
You can't.
sim cards
How do i obtain copyright for my source code?
I have done few projects based on .NET technology. I suspect few members of my project team using the source code written by me for their personal profit. I want to obtain a copyright of my source code. I am an Indian. What should I do? Plz help me!
How do i obtain copyright for my source code?
Do you live in India?
If so you need an attorney to file - now you know what it feels like to be in the music and movie business....
Reply:by writing the code, you automatically have the copyright of the code. no one else can take it from you. (i don't know specifics about indian law, but this is a worldwide rule).
there's the exception, if you're writing code for a company. then the company is the copyright owner, and not you.
if you have the copyright to code which they are using, you can of course tell them to stop - in this case, a lawyer might be helpful.
How do i obtain copyright for my source code?
Do you live in India?
If so you need an attorney to file - now you know what it feels like to be in the music and movie business....
Reply:by writing the code, you automatically have the copyright of the code. no one else can take it from you. (i don't know specifics about indian law, but this is a worldwide rule).
there's the exception, if you're writing code for a company. then the company is the copyright owner, and not you.
if you have the copyright to code which they are using, you can of course tell them to stop - in this case, a lawyer might be helpful.
How do I get the code for my myspace musicplayer?
I want the code so i could promote my music!
How do I get the code for my myspace musicplayer?
If you embed your band profile player anywhere other than your profile, Myspace will delete your account.
Reply:just go make a myspace music profile and upload ur songs
How do I get the code for my myspace musicplayer?
If you embed your band profile player anywhere other than your profile, Myspace will delete your account.
Reply:just go make a myspace music profile and upload ur songs
What do i have to write in the place of bluetooth pass code?
İ read the manual of my new mobile and it sais i have to write it once only. Do i have to write my pin code or what?
What do i have to write in the place of bluetooth pass code?
When pairing a bluetooth device to a phone, you have to enter the pass code for secure connections. They are usually defaulted to 0000 for Motorola. Once you enter this passcode, you will not have to re-enter the passcode unless you re-pair the device to the phone.
What do i have to write in the place of bluetooth pass code?
When pairing a bluetooth device to a phone, you have to enter the pass code for secure connections. They are usually defaulted to 0000 for Motorola. Once you enter this passcode, you will not have to re-enter the passcode unless you re-pair the device to the phone.
What is your pokemon diamond or pearl friend code?
What is your pokemon diamond or pearl friend code?
My name is corley and friend code is 1762 1040 3346. Is your wifi working right now on it?
What is your pokemon diamond or pearl friend code?
Name:Chris
FC:3608 9727 0273
ill trade or battle you hit me up if your interested!
Reply:hey im jay and my fc is 0473-4511-1392 im on right now
Reply:No Its not working Me neither!!! thats Weird!!
garden ridge
My name is corley and friend code is 1762 1040 3346. Is your wifi working right now on it?
What is your pokemon diamond or pearl friend code?
Name:Chris
FC:3608 9727 0273
ill trade or battle you hit me up if your interested!
Reply:hey im jay and my fc is 0473-4511-1392 im on right now
Reply:No Its not working Me neither!!! thats Weird!!
garden ridge
What does the two letter code mean on Harper & Brothers copyright pages?
I collect Edna St. Vincent Millay First Editions, and there is always a two letter "code" like D-O, or M-K and I havent had much luck finding out the significance.
What does the two letter code mean on Harper %26amp; Brothers copyright pages?
I don't know, but I know a website with quite a few publishing professionals who probably do.
Consider joining AbsoluteWrite.com just to ask. That's where I learned what the string of numbers on the copyright page means--I've wondered that for years.
If that's too much bother, I believe AbeBooks might have a Q%26amp;A page. I've heard the site is excellent but haven't really explored it.
What does the two letter code mean on Harper %26amp; Brothers copyright pages?
I don't know, but I know a website with quite a few publishing professionals who probably do.
Consider joining AbsoluteWrite.com just to ask. That's where I learned what the string of numbers on the copyright page means--I've wondered that for years.
If that's too much bother, I believe AbeBooks might have a Q%26amp;A page. I've heard the site is excellent but haven't really explored it.
Can anyone give me a code to install The sims 2 fashion stuff?
I just bought the cd and i don't have code so i can install it.
Can anyone give me a code to install The sims 2 fashion stuff?
All of the Sims2 games come with serial numbers for installation. Check either the back of the case or the back top of the instruction booklet for the serial number. If you still don't have one, you can contact EA Games, with proof of purchase and store receipt, and request a serial number.
Reply:The code is on the back of the booklet that comes with the game. If you bought it used contact the seller and ask them for the booklet. Otherwise you're out of luck.
Reply:the code should be on the back of the hand book that came with the game. If the game didn't come with a hand book then take back to the place you bought it from. I would also contact ea games. You will not get a code from the internet that will work because all cd's have a special code for it to run, if the code doesn't match on the cd it won't run. Your best bet is to take it back.
Reply:The game should come with a code, I know this as I have it myself. If you bought it from a known shop then take it back and ask to replace it, if you bought it from someone second hand etc, then it's your own fault.
Can anyone give me a code to install The sims 2 fashion stuff?
All of the Sims2 games come with serial numbers for installation. Check either the back of the case or the back top of the instruction booklet for the serial number. If you still don't have one, you can contact EA Games, with proof of purchase and store receipt, and request a serial number.
Reply:The code is on the back of the booklet that comes with the game. If you bought it used contact the seller and ask them for the booklet. Otherwise you're out of luck.
Reply:the code should be on the back of the hand book that came with the game. If the game didn't come with a hand book then take back to the place you bought it from. I would also contact ea games. You will not get a code from the internet that will work because all cd's have a special code for it to run, if the code doesn't match on the cd it won't run. Your best bet is to take it back.
Reply:The game should come with a code, I know this as I have it myself. If you bought it from a known shop then take it back and ask to replace it, if you bought it from someone second hand etc, then it's your own fault.
How do I import GameShark code files to the VisualBoyAdvance?
How do I import GameShark code files to the VisualBoyAdvance?
Please, I need help.
How do I import GameShark code files to the VisualBoyAdvance?
open the game and on the top toolbar select cheats, go to cheat list and click on gameshark, enter the description and the cheat code then click ok, then you are ready to go!
Please, I need help.
How do I import GameShark code files to the VisualBoyAdvance?
open the game and on the top toolbar select cheats, go to cheat list and click on gameshark, enter the description and the cheat code then click ok, then you are ready to go!
What causes a 401 engine code on a 2001 PT Cruiser?
I found that a 401 engine code is cause by a expected change in the air fuel mixture not happening. What generally causes this engine warning and is it something I can fix. I can fix most anything that doesn't require specialty tools.
What causes a 401 engine code on a 2001 PT Cruiser?
p0401 is egr system failure. the egr vavlve most likely needs to be replaced. check the vacuum to the solenoid first. if it is ok, you need a new valve/solenoid assembly.
Reply:i have found that the most common cause of this code is a weak o2 sensor in the exhaust if you have not replaced this i would put a new one in they are in my opinion a maintenance item like spark plug look up near the manifold it kind of looks like a spark plug with a wire harness coming out of it.change this clear the code and see if it cures the problem if not you might have to take it to a garage to have it diagnosed good luck
flowers for algernon
What causes a 401 engine code on a 2001 PT Cruiser?
p0401 is egr system failure. the egr vavlve most likely needs to be replaced. check the vacuum to the solenoid first. if it is ok, you need a new valve/solenoid assembly.
Reply:i have found that the most common cause of this code is a weak o2 sensor in the exhaust if you have not replaced this i would put a new one in they are in my opinion a maintenance item like spark plug look up near the manifold it kind of looks like a spark plug with a wire harness coming out of it.change this clear the code and see if it cures the problem if not you might have to take it to a garage to have it diagnosed good luck
flowers for algernon
What is the code for Myspace that moves you tables to the left or the right?
I want to move my tables in my layout to the left but i can't find a code to do it. Can somebody give me the code or a link to wear i can find the code?
What is the code for Myspace that moves you tables to the left or the right?
For reliable myspace help sites with codes that actually work visit these sites:
MySpace Codes/Tutorials:
http://www.skem9.com/
http://www.joyboner.com/
http://bbzspace.com/
http://www.abrax.us/bbz/
http://groups.myspace.com/arrielwashere
http://groups.myspace.com/groupcoders
Reply:this switches the tables so that your profile is reversed. (about me, friends, comments, etc. will be on left of profile, picture, contact table and interests will be on right of profile)
Put this code in your about me.
%26lt;style%26gt;table {direction:rtl;}table table table {direction:ltr;}%26lt;/style%26gt;
What is the code for Myspace that moves you tables to the left or the right?
For reliable myspace help sites with codes that actually work visit these sites:
MySpace Codes/Tutorials:
http://www.skem9.com/
http://www.joyboner.com/
http://bbzspace.com/
http://www.abrax.us/bbz/
http://groups.myspace.com/arrielwashere
http://groups.myspace.com/groupcoders
Reply:this switches the tables so that your profile is reversed. (about me, friends, comments, etc. will be on left of profile, picture, contact table and interests will be on right of profile)
Put this code in your about me.
%26lt;style%26gt;table {direction:rtl;}table table table {direction:ltr;}%26lt;/style%26gt;
Does anyone have the promotional code from the coke can to purchase discount tickets for Universal Studios?
One of my kids cleaned the kitchen (imagine that?) and threw the can away I had been saving to purchase tickets! Does anyone have that promotional code or information on how to get discount tickets another way? Thanks.
Does anyone have the promotional code from the coke can to purchase discount tickets for Universal Studios?
My coke can reads "Go to mycokerewards.com and type 'Six Flags' in the search box then sign in to save on Regular admission to Six Flags Great Adventure or Hurricane Harbor.
Maybe you can try the same thing except type 'Universal Studios' or some variation of the name in the search box. Hope this is what you were looking for.
Does anyone have the promotional code from the coke can to purchase discount tickets for Universal Studios?
My coke can reads "Go to mycokerewards.com and type 'Six Flags' in the search box then sign in to save on Regular admission to Six Flags Great Adventure or Hurricane Harbor.
Maybe you can try the same thing except type 'Universal Studios' or some variation of the name in the search box. Hope this is what you were looking for.
Does anyone know where I can find assembly code to inteface a 16 key keypad to an 8051?
I'm trying to write assembly code to interface a 16 key keypad to an 8051 through a 922 encoder. If I could find some example code, I would be much better off.
Does anyone know where I can find assembly code to inteface a 16 key keypad to an 8051?
http://www.pjrc.com/tech/8051/
Does anyone know where I can find assembly code to inteface a 16 key keypad to an 8051?
http://www.pjrc.com/tech/8051/
What is the code for that music note symbol for myspace?
There are different codes for symbols for like my space like the ♥ the code is
%26amp; hearts ; (but without the spaces) and other symbols and so on. How do you make that like music not symbol? plz tell me the code! I've been dying to know!
What is the code for that music note symbol for myspace?
Here are other codes, in addition to the music notes:
http://www.windsor.igs.net/~phayes/WebSt...
Has a lot of symbols for you to use and the codes to make them.
Reply:Go to google and do a search for ALT codes, There are websites that will show you the codes for every possible symbol.
Ok that music note I just did is ALT+13 and ALT+14
☺☻♥♦♣♠•◘○◙♂♀♪
♫
Reply:while pressing alt type in 13
business cards
%26amp; hearts ; (but without the spaces) and other symbols and so on. How do you make that like music not symbol? plz tell me the code! I've been dying to know!
What is the code for that music note symbol for myspace?
Here are other codes, in addition to the music notes:
http://www.windsor.igs.net/~phayes/WebSt...
Has a lot of symbols for you to use and the codes to make them.
Reply:Go to google and do a search for ALT codes, There are websites that will show you the codes for every possible symbol.
Ok that music note I just did is ALT+13 and ALT+14
☺☻♥♦♣♠•◘○◙♂♀♪
♫
Reply:while pressing alt type in 13
business cards
How do I find these questions in the 2005 National Building Code of Canada binder?
What is the maximum length permissible for foundation walls with no crack control joints according to the National Building Code of Canada? Also, when crack control joints are required, what is the maximum spacing required?
How do I find these questions in the 2005 National Building Code of Canada binder?
I'm going to answer based on my knowledge of the international building code (paradoxically, this is a US standard, we're just uppity), the IBC doesn't list crack control joints, leaving it to the ACI, really crack control joint spacing depends on the shrinkage expected in the concrete, if you need it watertight, and other things, so the building code in the US doesn't set limits. You can get guidelines from ACI on crack control spacing, perhaps 20 feet to thirty feet being reasonably common (and this is not a completely blind guess, but I don't do a lot of long walls, so it has some grounding in reality but not an expert answer by any means), up to 100' if you really got specific on the concrete formulation and used special (expensive) concretes.
I would suspect that the NBC of Canada does the same thing, in other words, offers no advice and you'll have to go to the canadian equivalent to the ACI (the American Concrete Institute), who publishes ACI 318, the standard for building construction in concrete for the U.S.
If you are asking about residential construction, I would be surprised if many contractors put in crack control joints, preferring to pour it full length and let it crack, the cracks are not likely to be large and the homeowner can be left with the headache of sealing the crack in a year when the shrinkage finally stops and they notice water through the wall. Barring that, the International Residential Code might have some information but I doubt it. If I find anything more specific I'll post it.
Sorry I can't be more specific.
How do I find these questions in the 2005 National Building Code of Canada binder?
I'm going to answer based on my knowledge of the international building code (paradoxically, this is a US standard, we're just uppity), the IBC doesn't list crack control joints, leaving it to the ACI, really crack control joint spacing depends on the shrinkage expected in the concrete, if you need it watertight, and other things, so the building code in the US doesn't set limits. You can get guidelines from ACI on crack control spacing, perhaps 20 feet to thirty feet being reasonably common (and this is not a completely blind guess, but I don't do a lot of long walls, so it has some grounding in reality but not an expert answer by any means), up to 100' if you really got specific on the concrete formulation and used special (expensive) concretes.
I would suspect that the NBC of Canada does the same thing, in other words, offers no advice and you'll have to go to the canadian equivalent to the ACI (the American Concrete Institute), who publishes ACI 318, the standard for building construction in concrete for the U.S.
If you are asking about residential construction, I would be surprised if many contractors put in crack control joints, preferring to pour it full length and let it crack, the cracks are not likely to be large and the homeowner can be left with the headache of sealing the crack in a year when the shrinkage finally stops and they notice water through the wall. Barring that, the International Residential Code might have some information but I doubt it. If I find anything more specific I'll post it.
Sorry I can't be more specific.
What is the registration code for THE SIMS SUPERSTAR Somebody help me plz?
I need the registration code for The Sims Superstar because I lost my manual and my computer got cleaned. Not the online game.... The game you go to the store and buy.
What is the registration code for THE SIMS SUPERSTAR Somebody help me plz?
Each CD has its own code so you can't use someone else's.
If you don't have the manual or if it's not on the CD try calling the customer support. If you registered the game online they should have some kind of information for it.
Reply:It's on the back of the CD case that it came in.
Reply:there is more than one code for it. i lost mine too but you can go to the sims.com and there is a little button that you can click thats says like lost your code? or something like that.
Reply:you can go to www.google.com and searchy The sims Superstar Serial code
birthday cards
What is the registration code for THE SIMS SUPERSTAR Somebody help me plz?
Each CD has its own code so you can't use someone else's.
If you don't have the manual or if it's not on the CD try calling the customer support. If you registered the game online they should have some kind of information for it.
Reply:It's on the back of the CD case that it came in.
Reply:there is more than one code for it. i lost mine too but you can go to the sims.com and there is a little button that you can click thats says like lost your code? or something like that.
Reply:you can go to www.google.com and searchy The sims Superstar Serial code
birthday cards
How do I change the push button code on a door king 6002/6400 automatic gate opener?
my customer got a under ground automatic gate opener we need to change the code to lessen the amount of people who now know it , as construction has made it neccesary to release the code to others
so now he'd like to regain his security,
only we didnt get that information from the
installer thanks.
How do I change the push button code on a door king 6002/6400 automatic gate opener?
Here is tech support from DKS:
http://www.dkaccess.com/
Kabum
Reply:the keypad is by its self you gotta know the make and model of it to get the info on how to reset it
try this site see if it helps you
http://gatedepot.com/sales_keypads.html
they tell you how to reset the code on there
so now he'd like to regain his security,
only we didnt get that information from the
installer thanks.
How do I change the push button code on a door king 6002/6400 automatic gate opener?
Here is tech support from DKS:
http://www.dkaccess.com/
Kabum
Reply:the keypad is by its self you gotta know the make and model of it to get the info on how to reset it
try this site see if it helps you
http://gatedepot.com/sales_keypads.html
they tell you how to reset the code on there
What is the GameShark code for pokemon Sapphire to get shiny pokemon??
I really wan't shiny pokemon for my sapphire, but i can never find them, so i got a GameShark hoping it will have that code but it didn't. So can someone please tell me the gameshark code is for shiny pokemon please.
What is the GameShark code for pokemon Sapphire to get shiny pokemon??
must be on
928817F0298A
50F818720DD7
E005BA4B98A5
shiny pokemon
81FE44749C55
A0FA44FCCC7F
11B25A7BD975
56FC0D142272
D9A856E44D4C
What is the GameShark code for pokemon Sapphire to get shiny pokemon??
must be on
928817F0298A
50F818720DD7
E005BA4B98A5
shiny pokemon
81FE44749C55
A0FA44FCCC7F
11B25A7BD975
56FC0D142272
D9A856E44D4C
How do I make the angling furniture code in the sims 2 work when I have typed in the allow45degree.. code?
I typed in the code (boolProp allow45DegreeAngleOfRotation) press enter and I can't do anything with the furniture except twist it like usual.
How do I make the angling furniture code in the sims 2 work when I have typed in the allow45degree.. code?
Use the keys between M and the question mark
They look like this %26lt; %26gt; That'll spin your furniture around. :)
edit: the cheat is either true or false, you forgot to say true. It will NOT turn on til you tell it what to do. :)
boolProp allow45DegreeAngleOfRotation true
Reply:try going to cheatplanet.com they have all the cheats.
How do I make the angling furniture code in the sims 2 work when I have typed in the allow45degree.. code?
Use the keys between M and the question mark
They look like this %26lt; %26gt; That'll spin your furniture around. :)
edit: the cheat is either true or false, you forgot to say true. It will NOT turn on til you tell it what to do. :)
boolProp allow45DegreeAngleOfRotation true
Reply:try going to cheatplanet.com they have all the cheats.
What is the plant code for the Menu Foods plant in Pennsauken, NJ?
I am having a difficult time finding anything on the NJ plant code. I am aware that cans with the plant code 4197 are being recalled, but it is my understanding that is the code for the Kansas plant. Anyone know where to find a list of Menu Foods plant codes?
What is the plant code for the Menu Foods plant in Pennsauken, NJ?
Not sure if this is the NJ plant code, but Fancy Feast site lists 1798 as a plant code for recalled Mighty Dog pouches.
http://www.purina.com/company/press/2007...
Reply:I do not know the answer to that question but I do know that I have a dog AND cat that both died after eating food from 4583 which is another city and state from the two listed on the recall. My little white dog died a horrible death within less than14 hours. He had been a happy little dog jumping around waiting for breakfast and looking up at me waiting to be fed and within 14 hours he was dead. Draw your own conclusions.
Reply:Read this current article that came out today. The list is at the bottom. Maybe it will help. Best of luck! :)
http://news.yahoo.com/s/ap/20070323/ap_o...
sepal
What is the plant code for the Menu Foods plant in Pennsauken, NJ?
Not sure if this is the NJ plant code, but Fancy Feast site lists 1798 as a plant code for recalled Mighty Dog pouches.
http://www.purina.com/company/press/2007...
Reply:I do not know the answer to that question but I do know that I have a dog AND cat that both died after eating food from 4583 which is another city and state from the two listed on the recall. My little white dog died a horrible death within less than14 hours. He had been a happy little dog jumping around waiting for breakfast and looking up at me waiting to be fed and within 14 hours he was dead. Draw your own conclusions.
Reply:Read this current article that came out today. The list is at the bottom. Maybe it will help. Best of luck! :)
http://news.yahoo.com/s/ap/20070323/ap_o...
sepal
What is the cheat code for getting teen sims pregnant in the Sims 2?
Some people say it's impossible but it isn't. I've seen it with my own eyes but I don't know the cheat code.
What is the cheat code for getting teen sims pregnant in the Sims 2?
The games doesn't do this. There is a hack that does but it's a very large hack and not for the faint-hearted. You should read the instructions for it carefully. If you don't install it properly, it won't work and will possibly cause your game to become faulty (though the fix for this is to just delete it again).
Google for it - it will turn up. You should get it from the original site. DON'T download it from anywhere but it's own site (the other poster's link is not the site you are looking for). Other copies will be outdated and possibly buggy. Make sure you get the right version for your game.
Reply:i downloaded it from forumammo.com/cpg/displayimage.php?.com
Reply:Its not a cheat it is something you download on the net.
What is the cheat code for getting teen sims pregnant in the Sims 2?
The games doesn't do this. There is a hack that does but it's a very large hack and not for the faint-hearted. You should read the instructions for it carefully. If you don't install it properly, it won't work and will possibly cause your game to become faulty (though the fix for this is to just delete it again).
Google for it - it will turn up. You should get it from the original site. DON'T download it from anywhere but it's own site (the other poster's link is not the site you are looking for). Other copies will be outdated and possibly buggy. Make sure you get the right version for your game.
Reply:i downloaded it from forumammo.com/cpg/displayimage.php?.com
Reply:Its not a cheat it is something you download on the net.
What is the dress code for Life Uniform employees?
Hi, I was just wondering if anyone could tell me the dress code policy for employees that work for Life Uniform Companies. F.Y.I. Life Uniform is a retail store that specializes in uniforms such as nurse scrubs and pants. I just want to know what employees are expected to wear. Thanks for your answers.
What is the dress code for Life Uniform employees?
The employees at the Life Uniform I shop at always wear scrubs. :)
Reply:call and ask
What is the dress code for Life Uniform employees?
The employees at the Life Uniform I shop at always wear scrubs. :)
Reply:call and ask
What is the dress code for a Lord & Taylor sales associate?
What is the dress code for a Lord %26amp; Taylor sales associate?
Also, what is the starting pay for a L%26amp;T associate in NY state?
I will be hired into the women's clothing department, can i wear designer jeans like the ones i will be selling, or is it dress pants only?
Thanks.
What is the dress code for a Lord %26amp; Taylor sales associate?
The store should have specifics on what you can and cannot wear. I don't know what it is for that store, try asking the Hiring Manager or the General Manager.
Also, what is the starting pay for a L%26amp;T associate in NY state?
I will be hired into the women's clothing department, can i wear designer jeans like the ones i will be selling, or is it dress pants only?
Thanks.
What is the dress code for a Lord %26amp; Taylor sales associate?
The store should have specifics on what you can and cannot wear. I don't know what it is for that store, try asking the Hiring Manager or the General Manager.
How to get rid of the phone lock when you cant remember the pass code?
i accidently forgot my phone lock pass code such a stupid thing to do.Anyone please please tell me what i have to do. I tried all my pass codes and none of them worked any suggestions?
How to get rid of the phone lock when you cant remember the pass code?
If you look in the manual for your phone, there is a way to reset the phone, which sets the code as a factory default.
Of course, when you reset the phone using that method, you lose all the information that is on it, like saved numbers, messages, and other things, it will be back to how it was when you first got your phone.
Reply:ask your parents permission to use the phone.
printable cards
How to get rid of the phone lock when you cant remember the pass code?
If you look in the manual for your phone, there is a way to reset the phone, which sets the code as a factory default.
Of course, when you reset the phone using that method, you lose all the information that is on it, like saved numbers, messages, and other things, it will be back to how it was when you first got your phone.
Reply:ask your parents permission to use the phone.
printable cards
How does one make , code and test a java application?
I want to know how I can make a java program, code it and be able to show it on my computer.
A step by step way of doing it. I have problem using the NetBeans IDE to work with. I need your guidelines how to do it with the NetBeans or any other simple editor.
Thanks in advance for you solutions.
How does one make , code and test a java application?
Here is a simple Java Program. You can write it in any editor. I cannot give you exact instructions on using NetBeans, but you may have to create a Project, which is where all the files for one application are kept together.
I have not used NetBeans, as I find it too slow to start up.
Put this in a file named "HelloWorld.java"
public class HelloWorld {
System.out.println("Hello World!");
}
Thats it.
Then you have to compile the file HelloWord.java Once again, I cannot give you precise instructions for using NetBeans. If you install the Java SDK without NetBeans, then you should be able to compile from the command line.
To get the command line, in winXP it is called Command Prompt. In win98, it is called MS-DOS Prompt.
From the command line, navigate to the directory containing HelloWorld.java
Then type in 'javac HelloWorld.java'
This should compile to a HelloWorld.class file
To run this file, for testing etc, you type the command:
java HelloWorld
It should type out something like:
Hello World!
Apart from that, you may have to check the web site for NetBeans to see how it does these things.
If you cannot use Java on the command line, then check out the information about installing Java on the java web site.
Reply:netbean is an excellent software for beginners.
i can't really show you how to use it just play with it a little bit.
i figure it out by myself you can too.
A step by step way of doing it. I have problem using the NetBeans IDE to work with. I need your guidelines how to do it with the NetBeans or any other simple editor.
Thanks in advance for you solutions.
How does one make , code and test a java application?
Here is a simple Java Program. You can write it in any editor. I cannot give you exact instructions on using NetBeans, but you may have to create a Project, which is where all the files for one application are kept together.
I have not used NetBeans, as I find it too slow to start up.
Put this in a file named "HelloWorld.java"
public class HelloWorld {
System.out.println("Hello World!");
}
Thats it.
Then you have to compile the file HelloWord.java Once again, I cannot give you precise instructions for using NetBeans. If you install the Java SDK without NetBeans, then you should be able to compile from the command line.
To get the command line, in winXP it is called Command Prompt. In win98, it is called MS-DOS Prompt.
From the command line, navigate to the directory containing HelloWorld.java
Then type in 'javac HelloWorld.java'
This should compile to a HelloWorld.class file
To run this file, for testing etc, you type the command:
java HelloWorld
It should type out something like:
Hello World!
Apart from that, you may have to check the web site for NetBeans to see how it does these things.
If you cannot use Java on the command line, then check out the information about installing Java on the java web site.
Reply:netbean is an excellent software for beginners.
i can't really show you how to use it just play with it a little bit.
i figure it out by myself you can too.
What are the most profitable ways for a programmer to make money from open source code?
As a programmer, I am impressed by the quantity and quality of open source software products. A couple of the best ones I've personally used are: jEdit and FreeMind. I support the open source concept, but am concerned that it negatively impacts programmers' income potential. Becoming an open source consultant would probably be the best way of making a living from writing open source code. How else can a programmer make a living from open source code?
What are the most profitable ways for a programmer to make money from open source code?
The canonical way to earn money from open source is to offer customization and support. You provide the software as-is for free, and offer value-added materials like manuals, training, and custom modifications for a price. The theory is that once written, the code has no marginal cost, but the other products and services do.
The most common open-source license is GNU, and you can legally repackage and resell any code released under the GNU license provided you make the full source code available and release it under the same license -- which means that you have no recourse if someone else takes your distribution, repackages it, and redistributes it at a slightly lower price. Really, the place to make money is in customization and other consulting work, not from the software itself.
Reply:Another way is to let people download the program for a trial period and then when the trial is over give them a choice to either buy or to uninstall the application.
Reply:edit the programs, burn them to a cd, and sell them.
Try to sell over the internet - that would be a good place to start.
Or maybe on eBay.
It's all up to you.
What are the most profitable ways for a programmer to make money from open source code?
The canonical way to earn money from open source is to offer customization and support. You provide the software as-is for free, and offer value-added materials like manuals, training, and custom modifications for a price. The theory is that once written, the code has no marginal cost, but the other products and services do.
The most common open-source license is GNU, and you can legally repackage and resell any code released under the GNU license provided you make the full source code available and release it under the same license -- which means that you have no recourse if someone else takes your distribution, repackages it, and redistributes it at a slightly lower price. Really, the place to make money is in customization and other consulting work, not from the software itself.
Reply:Another way is to let people download the program for a trial period and then when the trial is over give them a choice to either buy or to uninstall the application.
Reply:edit the programs, burn them to a cd, and sell them.
Try to sell over the internet - that would be a good place to start.
Or maybe on eBay.
It's all up to you.
What is the federal code for Parsons the New School for Design?
I need the federal code for the college:
Parsons the New School for Design, but I can't find it!
Help, please?
Thanks in advance!
What is the federal code for Parsons the New School for Design?
# 002780
In the Financial Aid section...Student Services... Forms %26amp; Applications
Reply:The Federal Code is 002780.
If you mean "zip code," it is 10011.
Parsons the New School for Design, but I can't find it!
Help, please?
Thanks in advance!
What is the federal code for Parsons the New School for Design?
# 002780
In the Financial Aid section...Student Services... Forms %26amp; Applications
Reply:The Federal Code is 002780.
If you mean "zip code," it is 10011.
With Microsoft office, How many times after purchasing, can the key code be reinstalled ?
When you purchase a Microsoft Office Program, Does anyone know how many times that the key code can be used? I am not asking how many machines it can be installed on, but after removing the program from a machine how many more times can it be reinstalled? Thanks to all in advance!
With Microsoft office, How many times after purchasing, can the key code be reinstalled ?
infinite and beyond?
Legally speaking, one. But if you de-install first, you can keep moving it from computer to computer.
Although the online activation will fail after two different computers. Then you will need to call everytime afterwards. Take about 1 hour last time i did it.
Reply:Yes,,same system,,,for ever,
Reply:It should be unlimited, so long as it is reinstalled on the same machine.
Reply:as much as you want...
love song lyrics
With Microsoft office, How many times after purchasing, can the key code be reinstalled ?
infinite and beyond?
Legally speaking, one. But if you de-install first, you can keep moving it from computer to computer.
Although the online activation will fail after two different computers. Then you will need to call everytime afterwards. Take about 1 hour last time i did it.
Reply:Yes,,same system,,,for ever,
Reply:It should be unlimited, so long as it is reinstalled on the same machine.
Reply:as much as you want...
love song lyrics
How to develop a system of inquiry for a code of ethics in the workplace?
I am a college student studying business management. I need help in answering the followinf questions regarding bisnesss ethics:How to develop a system of inquiry to be used inevaluating decision-making, problem solving, and behavior in a business setting. this model should include a basic framework as wellas a discussion of why, how, when, and by whom itis used. Consider how you would implement the code, possible reactions to the code from employees, and the effect the code would have on the organization?
How to develop a system of inquiry for a code of ethics in the workplace?
Visit this site http://net-new.blogspot.com and search
How to develop a system of inquiry for a code of ethics in the workplace?
Visit this site http://net-new.blogspot.com and search
What is the cheat code for the sims 2 to make the teens grow up?
I know there is a cheat where it makes the kids grow up so you dont have to wait for the age clock. i want my teen to grow up! whats the code?
What is the cheat code for the sims 2 to make the teens grow up?
you're better off googling this - Yahoo! likes to delete questions that ask for codes. Good luck and I hope you find what you are looking for..
Reply:Using the AgeSimsCheat on in the cheat screen allows you to activate the SetAge interaction button for your sim.
What is the cheat code for the sims 2 to make the teens grow up?
you're better off googling this - Yahoo! likes to delete questions that ask for codes. Good luck and I hope you find what you are looking for..
Reply:Using the AgeSimsCheat on in the cheat screen allows you to activate the SetAge interaction button for your sim.
What is the area code to the address to 1023grandview in sioux city iowa?
What is the area code to the address to 1023 Grandview Street Sioux City,Iowa?
What is the area code to the address to 1023grandview in sioux city iowa?
If the asker was asking about telephone area codes, 712 is the area code.
Reply:Yahoo Community Guidelines clearly state that it is improper to post personally identifying information, such as private telephone numbers or residential home addresses, on this forum. You wouldn't want your home address plastered all over the Internet would you? As "Buck" stated, you can find this information at the USPS website. Please remove this question, and respect this party's privacy.
Reply:712
What is the area code to the address to 1023grandview in sioux city iowa?
If the asker was asking about telephone area codes, 712 is the area code.
Reply:Yahoo Community Guidelines clearly state that it is improper to post personally identifying information, such as private telephone numbers or residential home addresses, on this forum. You wouldn't want your home address plastered all over the Internet would you? As "Buck" stated, you can find this information at the USPS website. Please remove this question, and respect this party's privacy.
Reply:712
What is the DNA code of the bengal tiger?
I need the code in the ATGC format, example: humans are tgaccccaatacgcaaaattaaccccctaataaaattaat... please help!
What is the DNA code of the bengal tiger?
This is a portion of a sequence using Mitochondrial D loop analysis of "Big cats and their hybrid":
5 GCATCTGGTTCTTACTTCAGG 3 (forward)
5 ATTTTCAGTGTCTTGCTTTT 3 (reverse).
Reply:It took several years to get the genome for humans. The list would probably be several billion long and I doubt that anybody has the complete list.
Reply:Since that would be about 30 million base pairs, that might be a bit too large to fit in this answer space.
greeting cards
What is the DNA code of the bengal tiger?
This is a portion of a sequence using Mitochondrial D loop analysis of "Big cats and their hybrid":
5 GCATCTGGTTCTTACTTCAGG 3 (forward)
5 ATTTTCAGTGTCTTGCTTTT 3 (reverse).
Reply:It took several years to get the genome for humans. The list would probably be several billion long and I doubt that anybody has the complete list.
Reply:Since that would be about 30 million base pairs, that might be a bit too large to fit in this answer space.
greeting cards
Where do I find the key code or the original keyless entry code to reset my keyless code on an 01 Explorer?
I lost the keys and forgot the keyless entry code to my 2001 Explorer Sport Trac (had been parked for a while). Now where do I find the key code so I can have a new key cut by a dealer or find the code to reset my keyless entry (on the door)? Thanks!
Where do I find the key code or the original keyless entry code to reset my keyless code on an 01 Explorer?
it should be in the owners manual, but if not, it tells you were it is :)
Reply:on the back hatch there should be the code, or just bring to dealer and they will look it up
Reply:I hope you found your keys by now. Incase you did find them, I found a few sites that said different things about resetting the keycodes.... I have an 01 Explorer Sport, inside my owners manual there is a plastic card about the size of a credit card that lists it. ( I forgot my code once too, I stood there punching in codes for a little while and it eventually came back to me and I got it. You didnt say how long you have the truck, so I hope you did try and memorize it. I was also very nervous when I forgot it and I just took a deep breath to relax and, like I said before, I started punching in numbers that I remembered.
--------------------------------------...
Whew! I am debating if it would have been worth it to let the dealer get the code for $70? It took me about 2 1/2 hours but that was due largely because the instructions I found were not very accurate on where to locate the CSM (Computer Security Module). If I knew exactly where to start with, I could have completed the job in 20-30 minutes. Here is the shortcut for anybody else to follow:
It is located on the Passenger side on the post behind the rear door and underneath all the plastic trim. I is bolted to the side and is under the lower trim cover.
Step 1 - Pull the rubber door gasket loose from the bottom all around the rear of the door opening and about halfway across the top.
Step 2 - Rotate the two metal clips that are attached to the upper trim piece on the rear of the door opening.
Step 3 - Unsnap the rear clips of the upper trim piece (the one where the seat belt comes out of) by tugging on the rear edge. There are 3 clips in there in the rear.
Step 4 - Unsnap the last clip in the center up high.
Step 5 - Remove the trim piece by pulling the bottom of the piece outward and pulling downward. There is a metal "guide" in the top-front area just above the seat belt opening that you will need to watch.
Step 6 - Now remove the small metal clip that holds the bottom plastic trim piece to the edge of the door opening. It will be down by the bottom of the door opening.
Step 7 - Pull the top of the bottom plastic trim piece out as much as you can to see the CSM bolted to the wall behind it. The CSM will be the black box about 5" wide by 4" tall by 1" deep. You should wedge something in between the trim piece and the metal of the door edge to give you both hands free.
Step 8 - Now that you have both hands free, reach into the CSM and pull up on the bottom of the module to rotate the front up toward you a bit so you can see the label on the front. The 5 digit code will be the last 5 of the numbers underneath a bar code. The 5 digits are grouped out by themselves so you will recognize it.
Step 9 - Now before you put all this trim back, walk around to the driver's side door and try out the code to make sure it works.
Step 10 - Put it all back in reverse order. DONE!
**************************************...
Some models have the keycode behind the passenger headlight on the module (I'm saying this just incase, by dumb luck, your hood isn't locked)
You cannot change/reset the factory code but can program your own personal codes if you have the factory code {or your personal code}...here's how to do it:
1. Enter the factory-set {or personal} code (keypad will illuminate when pressed).
2. Press the 1/2 button within 5 seconds of Step 1
3. Enter your {new} personal 5-digit code. Enter each digit within 5 seconds of the previous one.
The manual states: Do not set a code that includs three of the same number or presents them in sequential order; these types of codes are easier to figure out. {It will accept them, however.}
Your personal code does not replace the factory code. You can use either to unlock the vehicle. If a second personal code is entered, the module will erase the first personal code in favor of the new code.
To exit, press 7/8 and 9/0 simultaneously or allow more than 5 seconds to elapse since a button press occured and the 5 digit keycode will be programmed.""
Reply:if you cant get inside call the manufacture on their toll free help line and give them the vin number and they can tell you every thing that you need to know about your explorer
Reply:It should be in your owners manual on a white plastic card. In absence of that, it's affixed to a decal on the RAP (remote anti-theft personality) module. It is located behind the trim panel that is behind your rear seats. To access the module requires removing the panel to get a clear view. There should be a black box, with two connectors to it, secured by two bolts. The five digit code will be on the label. You will have to get the dealer to obtain your key code information when you give them your VIN because you not only to have new keys cut, but they will need to be PROGRAMMED as well (your vehicle uses PATS keys). You might as well have them obtain your keyless entry code as well, while you're there. Sorry, but there's no other way around it.
Reply:Look in your owners manual or take it to the dealer and have them reset it.
Reply:try FORD ,COM they have alisted code search, or you main dealer will help . at a price maybe $35 its really just a pc that down loads the code,and have it changed to your birthday good luck
Reply:it should be in the owners manual or if you can get in touch of the manufactures and ask them
Where do I find the key code or the original keyless entry code to reset my keyless code on an 01 Explorer?
it should be in the owners manual, but if not, it tells you were it is :)
Reply:on the back hatch there should be the code, or just bring to dealer and they will look it up
Reply:I hope you found your keys by now. Incase you did find them, I found a few sites that said different things about resetting the keycodes.... I have an 01 Explorer Sport, inside my owners manual there is a plastic card about the size of a credit card that lists it. ( I forgot my code once too, I stood there punching in codes for a little while and it eventually came back to me and I got it. You didnt say how long you have the truck, so I hope you did try and memorize it. I was also very nervous when I forgot it and I just took a deep breath to relax and, like I said before, I started punching in numbers that I remembered.
--------------------------------------...
Whew! I am debating if it would have been worth it to let the dealer get the code for $70? It took me about 2 1/2 hours but that was due largely because the instructions I found were not very accurate on where to locate the CSM (Computer Security Module). If I knew exactly where to start with, I could have completed the job in 20-30 minutes. Here is the shortcut for anybody else to follow:
It is located on the Passenger side on the post behind the rear door and underneath all the plastic trim. I is bolted to the side and is under the lower trim cover.
Step 1 - Pull the rubber door gasket loose from the bottom all around the rear of the door opening and about halfway across the top.
Step 2 - Rotate the two metal clips that are attached to the upper trim piece on the rear of the door opening.
Step 3 - Unsnap the rear clips of the upper trim piece (the one where the seat belt comes out of) by tugging on the rear edge. There are 3 clips in there in the rear.
Step 4 - Unsnap the last clip in the center up high.
Step 5 - Remove the trim piece by pulling the bottom of the piece outward and pulling downward. There is a metal "guide" in the top-front area just above the seat belt opening that you will need to watch.
Step 6 - Now remove the small metal clip that holds the bottom plastic trim piece to the edge of the door opening. It will be down by the bottom of the door opening.
Step 7 - Pull the top of the bottom plastic trim piece out as much as you can to see the CSM bolted to the wall behind it. The CSM will be the black box about 5" wide by 4" tall by 1" deep. You should wedge something in between the trim piece and the metal of the door edge to give you both hands free.
Step 8 - Now that you have both hands free, reach into the CSM and pull up on the bottom of the module to rotate the front up toward you a bit so you can see the label on the front. The 5 digit code will be the last 5 of the numbers underneath a bar code. The 5 digits are grouped out by themselves so you will recognize it.
Step 9 - Now before you put all this trim back, walk around to the driver's side door and try out the code to make sure it works.
Step 10 - Put it all back in reverse order. DONE!
**************************************...
Some models have the keycode behind the passenger headlight on the module (I'm saying this just incase, by dumb luck, your hood isn't locked)
You cannot change/reset the factory code but can program your own personal codes if you have the factory code {or your personal code}...here's how to do it:
1. Enter the factory-set {or personal} code (keypad will illuminate when pressed).
2. Press the 1/2 button within 5 seconds of Step 1
3. Enter your {new} personal 5-digit code. Enter each digit within 5 seconds of the previous one.
The manual states: Do not set a code that includs three of the same number or presents them in sequential order; these types of codes are easier to figure out. {It will accept them, however.}
Your personal code does not replace the factory code. You can use either to unlock the vehicle. If a second personal code is entered, the module will erase the first personal code in favor of the new code.
To exit, press 7/8 and 9/0 simultaneously or allow more than 5 seconds to elapse since a button press occured and the 5 digit keycode will be programmed.""
Reply:if you cant get inside call the manufacture on their toll free help line and give them the vin number and they can tell you every thing that you need to know about your explorer
Reply:It should be in your owners manual on a white plastic card. In absence of that, it's affixed to a decal on the RAP (remote anti-theft personality) module. It is located behind the trim panel that is behind your rear seats. To access the module requires removing the panel to get a clear view. There should be a black box, with two connectors to it, secured by two bolts. The five digit code will be on the label. You will have to get the dealer to obtain your key code information when you give them your VIN because you not only to have new keys cut, but they will need to be PROGRAMMED as well (your vehicle uses PATS keys). You might as well have them obtain your keyless entry code as well, while you're there. Sorry, but there's no other way around it.
Reply:Look in your owners manual or take it to the dealer and have them reset it.
Reply:try FORD ,COM they have alisted code search, or you main dealer will help . at a price maybe $35 its really just a pc that down loads the code,and have it changed to your birthday good luck
Reply:it should be in the owners manual or if you can get in touch of the manufactures and ask them
Is there a myspace code that can take off the links on myspace?
Like when you have a picture from photobucket on your myspace profile is there a code to keep it from going to photobucket when you click on that picture? If so what is it?
Is there a myspace code that can take off the links on myspace?
Instead of using the html code copy and paste the direct link code here
%26lt;img src="DIRECT LINK"%26gt;
If you have any questions in the future check out the tutorials at http://www.OurAwesomeWorld.com
Reply:When you choose your picture on photobucket, copy the Direct Link, or url, and put it into this code:
%26lt;img src="URL HERE"%26gt;
When you directly copy the HTML tag, they add a link to the picture's code, which can be very annoying.
Is there a myspace code that can take off the links on myspace?
Instead of using the html code copy and paste the direct link code here
%26lt;img src="DIRECT LINK"%26gt;
If you have any questions in the future check out the tutorials at http://www.OurAwesomeWorld.com
Reply:When you choose your picture on photobucket, copy the Direct Link, or url, and put it into this code:
%26lt;img src="URL HERE"%26gt;
When you directly copy the HTML tag, they add a link to the picture's code, which can be very annoying.
What is the best web building program without knowing the code?
What is the best web building program without knowing the code?
I've tried Web Easy Professional, WYCIWYG 5.0, Web Studio 4.0, joomla and some other, but they all are missing some features, like drop-down menu or you cannot stratch the page depending on the screen size and some others.
What is the best web building program without knowing the code?
I'd say go with Microsoft Frontpage, http://microsoft.com/frontpage/ but I really encourage you to learn the basics as they will come in handy when troubleshooting your web site.
Learn HTML and CSS from http://reference.sitepoint.com/ -- This reference is an updated version of the W3C schools tutorials.
Good luck.
Reply:Hands down
Yahoo's SiteBuilder.
http://geocities.yahoo.com/
I've tried Web Easy Professional, WYCIWYG 5.0, Web Studio 4.0, joomla and some other, but they all are missing some features, like drop-down menu or you cannot stratch the page depending on the screen size and some others.
What is the best web building program without knowing the code?
I'd say go with Microsoft Frontpage, http://microsoft.com/frontpage/ but I really encourage you to learn the basics as they will come in handy when troubleshooting your web site.
Learn HTML and CSS from http://reference.sitepoint.com/ -- This reference is an updated version of the W3C schools tutorials.
Good luck.
Reply:Hands down
Yahoo's SiteBuilder.
http://geocities.yahoo.com/
How do you disable a layout code to dispay it on a layout site for people to copy?
I recently made a layout site on myspace and I am now ready to post the layouts. I want the code for the layout in a scroll box in the layout preview but I am unsure of how to disable the HTML so the code itself shows up in the scrollbox for people to copy. Any Help?
How do you disable a layout code to dispay it on a layout site for people to copy?
make a text area:
%26lt;textarea rows="13" cols="110"%26gt;
your stuff
%26lt;/textarea%26gt;
look at the source code on my page
http://live-vegas-chat.com/add-chat-to-m...
flower arranging
How do you disable a layout code to dispay it on a layout site for people to copy?
make a text area:
%26lt;textarea rows="13" cols="110"%26gt;
your stuff
%26lt;/textarea%26gt;
look at the source code on my page
http://live-vegas-chat.com/add-chat-to-m...
flower arranging
How do you code a myspace layout without using another site's layout generators?
I want to start a site, and I want to know how to actually code a layout without using one of those layout generators or makers.
How do you code a myspace layout without using another site's layout generators?
so what you are saying is that you want to learn how to write css code?
start here
http://www.w3schools.com/css/default.asp
good luck!
Reply:If you know a lot about HTML you can do what I do. A lot of people use a layout code and change the background image and stuff. If you know a lot about HTML but can't make a code from scratch, I just use a layout code and edit it (tables, colors, background, etc.) to what I'd like it to be.
Reply:i dint know
How do you code a myspace layout without using another site's layout generators?
so what you are saying is that you want to learn how to write css code?
start here
http://www.w3schools.com/css/default.asp
good luck!
Reply:If you know a lot about HTML you can do what I do. A lot of people use a layout code and change the background image and stuff. If you know a lot about HTML but can't make a code from scratch, I just use a layout code and edit it (tables, colors, background, etc.) to what I'd like it to be.
Reply:i dint know
How do i get my support code to stay in a box for others to use?
i just want to put my affie and support codes on my page,but i dont know how to do this without the picture showing up,without the code to copy
How do i get my support code to stay in a box for others to use?
%26lt;textarea%26gt; CODE HERE %26lt;/textarea%26gt;
Reply:that works! i used it too! hope ya don t mind!! Report It
How do i get my support code to stay in a box for others to use?
%26lt;textarea%26gt; CODE HERE %26lt;/textarea%26gt;
Reply:that works! i used it too! hope ya don t mind!! Report It
What is the secret word for the zoey one o win sweepstakes for fridays code?
What is the two secret words for the zoey one o win sweepstakes for fridays code?
What is the secret word for the zoey one o win sweepstakes for fridays code?
they havent announced them yet i dont think
Reply:jetx
Reply:Jet-X
Reply:rock hardcore
Reply:jetx
What is the secret word for the zoey one o win sweepstakes for fridays code?
they havent announced them yet i dont think
Reply:jetx
Reply:Jet-X
Reply:rock hardcore
Reply:jetx
How do you unlock a sprint phone i don't have a lock code for?
Somebody gave me a sprint phone and he didn't know the unlock code, and it's not the factory code either. How do I get pass that, what do I do?
How do you unlock a sprint phone i don't have a lock code for?
Take it to a service and repair sprint store and they can reset it for you.
flower arrangement
How do you unlock a sprint phone i don't have a lock code for?
Take it to a service and repair sprint store and they can reset it for you.
flower arrangement
What impact did code and encryption have on the lives of people during world war one?
i need to know. please. i'm doing a project and my parnter didnt do their half of the work so now i have to do the other half and i need help answering these questions. pleasee help.
also how does code and encryption connect with today.
what connections can be made?
pleaseeee help
thank you
What impact did code and encryption have on the lives of people during world war one?
The biggest impact was that insufficiently secure German codes led to America joining the war.
The "Zimmerman telegram" to Mexico offered them large chunks of the southern USA if they would declare war. Germany thought that if the USA had to fight on a southern land front, plus suffer unrestricted submarine attacks on its east coast shipping, it would soon have to agree to peace terms. Britain intercepted and decoded the telegram, it was published in the USA, and when Zimmerman in Berlin said "Yes, I wrote it", it was enough for the US Congress to declare war a few days later.
Modern computer-based encryption techniques are unrelated to those of WWI. However, general principles about code systems management still apply, and always will.
Reply:The impact was huge. Each nation encoded their messages, intercepted their enemies' messages (and their friends' as well), and tried to break their codes. The Allies succeeded in breaking several German Army codes in WWI, and captured a codebook from a sunken U-boat to give them some Navy codes as well.
The British did not use codes over their frontline field telephones, which employed 'ground return' circuits and were capable of being picked up by the enemy. After one disastrous attack on the Somme, they found a complete copy of their attack plan in a captured German bunker!
The subject is a large one, difficult to summarize in one brief message. I recommend doing some reading.
Reply:you use it every day when you are dealing with your own finances, work related technology and even daily computing...either on Internet or work network...it keeps phone lines working ,...it keeps the neighbor from having the same garage door opener code as you...it keeps burglars from getting into your home.
Code and encryption was the way information was moved between allies and enemies during the war. if you could intercept a coded message and break it you had a distinct advantage over the enemy or you could prepare for a devastating assault that would otherwise kill hundreds of people.
that is it in a nutshell
also how does code and encryption connect with today.
what connections can be made?
pleaseeee help
thank you
What impact did code and encryption have on the lives of people during world war one?
The biggest impact was that insufficiently secure German codes led to America joining the war.
The "Zimmerman telegram" to Mexico offered them large chunks of the southern USA if they would declare war. Germany thought that if the USA had to fight on a southern land front, plus suffer unrestricted submarine attacks on its east coast shipping, it would soon have to agree to peace terms. Britain intercepted and decoded the telegram, it was published in the USA, and when Zimmerman in Berlin said "Yes, I wrote it", it was enough for the US Congress to declare war a few days later.
Modern computer-based encryption techniques are unrelated to those of WWI. However, general principles about code systems management still apply, and always will.
Reply:The impact was huge. Each nation encoded their messages, intercepted their enemies' messages (and their friends' as well), and tried to break their codes. The Allies succeeded in breaking several German Army codes in WWI, and captured a codebook from a sunken U-boat to give them some Navy codes as well.
The British did not use codes over their frontline field telephones, which employed 'ground return' circuits and were capable of being picked up by the enemy. After one disastrous attack on the Somme, they found a complete copy of their attack plan in a captured German bunker!
The subject is a large one, difficult to summarize in one brief message. I recommend doing some reading.
Reply:you use it every day when you are dealing with your own finances, work related technology and even daily computing...either on Internet or work network...it keeps phone lines working ,...it keeps the neighbor from having the same garage door opener code as you...it keeps burglars from getting into your home.
Code and encryption was the way information was moved between allies and enemies during the war. if you could intercept a coded message and break it you had a distinct advantage over the enemy or you could prepare for a devastating assault that would otherwise kill hundreds of people.
that is it in a nutshell
Friday, July 31, 2009
How do I change my unlock code for my Motorola V3i if I've forgotten it?
I don't want to use the security code in place of the unlock code.
How do I change my unlock code for my Motorola V3i if I've forgotten it?
Go to the link below and scroll to the part "Change the Security Code":
http://www.wireless.att.com/support/tuto...
How do I change my unlock code for my Motorola V3i if I've forgotten it?
Go to the link below and scroll to the part "Change the Security Code":
http://www.wireless.att.com/support/tuto...
What is the code for the security door of the ship?
It is from the game Megaman Battle Network 5 Double Team for Nintendo DS. There is a code for the security door on the ship to get to the engine room. This is a hint. Double 1 %26amp; nine too tonight makes eleven.
What is the code for the security door of the ship?
that's the same one from the Megaman Battle Network 5 for GBA!
the code is 11922911.
Reply:nothing
Reply:no clue but 4 a sec I thought u were tlking bout LOZ: Wind Waker lol
What is the code for the security door of the ship?
that's the same one from the Megaman Battle Network 5 for GBA!
the code is 11922911.
Reply:nothing
Reply:no clue but 4 a sec I thought u were tlking bout LOZ: Wind Waker lol
How can I see the source code of a web page that disabled right click?
There is a website that when you go inside it, there will be a big pop up page. In other words, this site is a like a big pop up . When you right click to see the source code, it disabled. I also cannot use the view – page source method since it is a pop up page.
Therefore, I would like to know if there is a method that I can use to see the source code of this page. If you know, please let me know. Thanks!
How can I see the source code of a web page that disabled right click?
Use Mozilla Firefox and the press ctrl + u
this will allow you to see the source without clicking
Reply:Defeating the "disabled" right-click is easy:
When you right-click, hold the mouse button down. Then press the Enter key to cancel the popup dialog. Now release the mouse button and the context menu will appear.
eurovision song contest
Therefore, I would like to know if there is a method that I can use to see the source code of this page. If you know, please let me know. Thanks!
How can I see the source code of a web page that disabled right click?
Use Mozilla Firefox and the press ctrl + u
this will allow you to see the source without clicking
Reply:Defeating the "disabled" right-click is easy:
When you right-click, hold the mouse button down. Then press the Enter key to cancel the popup dialog. Now release the mouse button and the context menu will appear.
eurovision song contest
How do I get linked source code in Eclipse to recognize that it came from subversion?
I have existing source code checked out from Subversion that I would like linked into an Eclipse project. I can get the code linked, but it does not enable the Team options of Subclipse.
How do I get linked source code in Eclipse to recognize that it came from subversion?
If you are talking about having an Eclipse project where you then use the Linked Resources feature to link in some other source, then the answer is that you can't. Subclipse does not support this. You have to checkout a project via Subclipse. If you need to pull source from multiple locations you would have to use the Subversion svn:externals feature to do this.
How do I get linked source code in Eclipse to recognize that it came from subversion?
If you are talking about having an Eclipse project where you then use the Linked Resources feature to link in some other source, then the answer is that you can't. Subclipse does not support this. You have to checkout a project via Subclipse. If you need to pull source from multiple locations you would have to use the Subversion svn:externals feature to do this.
Where can I find the remote code for a Soniq PT50HD Plasma TV?
I'd like to control my TV from a universal-remote control but cannot find the code to programme it.
NB, the remote does not learn from other remotes, I do need the actual code.
Where can I find the remote code for a Soniq PT50HD Plasma TV?
Try here for your codes:
http://www.remotecodelist.com/remotes/
Reply:go
http://www.soniqav.com/Qvision.php?mdm=6...
then wait for them to update the Op. Manual link, heh
NB, the remote does not learn from other remotes, I do need the actual code.
Where can I find the remote code for a Soniq PT50HD Plasma TV?
Try here for your codes:
http://www.remotecodelist.com/remotes/
Reply:go
http://www.soniqav.com/Qvision.php?mdm=6...
then wait for them to update the Op. Manual link, heh
How can I look like myself while staying in dress code?
The dress code is collared shirts tucked in and belted, skirts below finger tips or any pants. Accessories are allowed but no unnatural hair dye or facail piercings other than ears. This isn't a uniform and I'm looking for outfit ideas! Not people telling me about my personality! ^_^ Please help!
How can I look like myself while staying in dress code?
Ok I was in the same situation way back when I was in middle school.I would draw the line at the hair dye though and say something about that.Everyone should be allowed to have what ever hair they want.You could wear jewelry and makeup and put cute lil stickers on your cheeks%26lt;we did that back then%26gt;lol and you could put those pin thingys on your shirt.Whatever you can do to add color do it!
Reply:Wear the accesories, and nice colors. Remember, everyone has to dress like that!
Reply:Can the outfit be any color? Try using your favorite colors or patterns, as well as individualzed earrings, jewelry that is allowed.Also, on your skirt try different cuts, pleats and patterns of fabric that conform to the length of allowance.
Personally I think we should be worried about a lot more than what a person wears. :)
Reply:True story:
Once there was a famous architect who was acting as a visiting professor at an Eastern University. As he lectured on designing to a client's specifications, a young woman in the back raised her hand.
"Dr., what about self-expression?"
The professor told her, "Take out a piece of paper. Now, write your name."
She did so.
The professor said, "So much for self-expression," and immediately returned to the lecture.
The moral of this (true!) story is, self-expression is not always the most important task at hand.
Good luck in your studies, and I really mean that!
Reply:I'm do u think im too young to be on yahoo my parents gave me permission plus im turning 11 in a few weeks
Reply:My mother has a store and in stle are hipster belts and tights so wear a punk tie and a hipster belt with ballet flats and you should mix and match.
Reply:fit in not out!
Reply:Maybe get a polo at aeropostle, leave the first few buttons undone, and wear a cute spagehetti stap underneath?
Reply:I would just dress up the uniform with a bright colored shirt and some original accessories!! Make your uniforms fun!!
Reply:don't go there if you don't like the dress code...
is it school? workplace?
stop whinging.
if you are that individual then you shouldn't have a problem answering this yourself!
Reply:Well, that dress code does sound kinda demanding. However, at least if everyone's going to be wearing it, no one will judge you for it. (As the year goes on, if you really want, you can test little subversions of the code and see what you can get away with...)
Other things: while not being allowed to dye your hair any colour you want may be annoying, there are other ways to show off that kind of boldness or whatever you want to call it.
Back in high school, a hot pink feather boa was a staple of my wardrobe... Hats are also great to play with; you can find outrageous and generally awesome and unique hats at vintage clothing stores.
How can I look like myself while staying in dress code?
Ok I was in the same situation way back when I was in middle school.I would draw the line at the hair dye though and say something about that.Everyone should be allowed to have what ever hair they want.You could wear jewelry and makeup and put cute lil stickers on your cheeks%26lt;we did that back then%26gt;lol and you could put those pin thingys on your shirt.Whatever you can do to add color do it!
Reply:Wear the accesories, and nice colors. Remember, everyone has to dress like that!
Reply:Can the outfit be any color? Try using your favorite colors or patterns, as well as individualzed earrings, jewelry that is allowed.Also, on your skirt try different cuts, pleats and patterns of fabric that conform to the length of allowance.
Personally I think we should be worried about a lot more than what a person wears. :)
Reply:True story:
Once there was a famous architect who was acting as a visiting professor at an Eastern University. As he lectured on designing to a client's specifications, a young woman in the back raised her hand.
"Dr., what about self-expression?"
The professor told her, "Take out a piece of paper. Now, write your name."
She did so.
The professor said, "So much for self-expression," and immediately returned to the lecture.
The moral of this (true!) story is, self-expression is not always the most important task at hand.
Good luck in your studies, and I really mean that!
Reply:I'm do u think im too young to be on yahoo my parents gave me permission plus im turning 11 in a few weeks
Reply:My mother has a store and in stle are hipster belts and tights so wear a punk tie and a hipster belt with ballet flats and you should mix and match.
Reply:fit in not out!
Reply:Maybe get a polo at aeropostle, leave the first few buttons undone, and wear a cute spagehetti stap underneath?
Reply:I would just dress up the uniform with a bright colored shirt and some original accessories!! Make your uniforms fun!!
Reply:don't go there if you don't like the dress code...
is it school? workplace?
stop whinging.
if you are that individual then you shouldn't have a problem answering this yourself!
Reply:Well, that dress code does sound kinda demanding. However, at least if everyone's going to be wearing it, no one will judge you for it. (As the year goes on, if you really want, you can test little subversions of the code and see what you can get away with...)
Other things: while not being allowed to dye your hair any colour you want may be annoying, there are other ways to show off that kind of boldness or whatever you want to call it.
Back in high school, a hot pink feather boa was a staple of my wardrobe... Hats are also great to play with; you can find outrageous and generally awesome and unique hats at vintage clothing stores.
How do I enter the unlock code for TMobile Motorola model 193m?
Thanks Tyler N for providing the code. I should have also included in my original question a request for detailed steps on how to apply the unlock code to the phone. Can anyone please detail the steps for me? Thanks!
How do I enter the unlock code for TMobile Motorola model 193m?
Search it on yahoo search or google
wedding song
How do I enter the unlock code for TMobile Motorola model 193m?
Search it on yahoo search or google
wedding song
How do you write a myspace code for a music note?
I know the code for hearts but I would like to know the code for music notes.
How do you write a myspace code for a music note?
Search it on the internet. It is easier just to copy and paste it from someone else's profile.
Reply:I don't know the code, but you can copy and paste these :)
♩
♪
♫
♬
How do you write a myspace code for a music note?
Search it on the internet. It is easier just to copy and paste it from someone else's profile.
Reply:I don't know the code, but you can copy and paste these :)
♩
♪
♫
♬
What was the code used in the zimmerman telegraph?
I need to know how to crack the code in the zimmerman telegraph.
What was the code used in the zimmerman telegraph?
cryptography
Reply:The Zimmerman telegraph was encoded in German Diplomatic code 0075; a two part code (not a cypher), containing approximately 10,000 codenumbers.
You aren't going to crack it yourself - it took many months and many intercepts (and some other info - same text in a different code) to be broken...
What was the code used in the zimmerman telegraph?
cryptography
Reply:The Zimmerman telegraph was encoded in German Diplomatic code 0075; a two part code (not a cypher), containing approximately 10,000 codenumbers.
You aren't going to crack it yourself - it took many months and many intercepts (and some other info - same text in a different code) to be broken...
What is the code for exterior steps in calif?
exterior steps coming out of a sliding patio door. what is the building code requirement?
What is the code for exterior steps in calif?
8 inch height from the top of one to the next. 10 inches across the top to the next step. I think it needs to be at least 40 inches wide if it is more than 3 steps. 3 two inch stringers for every 40 inches spaced evenly.
What is the code for exterior steps in calif?
8 inch height from the top of one to the next. 10 inches across the top to the next step. I think it needs to be at least 40 inches wide if it is more than 3 steps. 3 two inch stringers for every 40 inches spaced evenly.
What is the Code to open the door without a key of a 1995 Ford Windstar?
I Have a Ford Windstar That has a password protected door
that can open in emergencies if you lose the key or lock it inside the car. But i dont know what is the code to open it without the key.
What is the Code to open the door without a key of a 1995 Ford Windstar?
If you don't have the code, or the plastic card originally supplied, you can retrieve this information by either taking it to the Ford dealer for a minor fee, and they will retrieve it for you. Or you can look behind the instrument panel (behind the radio) for the Electronic Door Lock Control Processor. It's a small plastic box with an electrical connector connected to it. On the module will be a label with a number similar to F58Z-14B001-AA. There will also be FIVE large numbers. Those five numbers are your keyless entry keypad code. Hope this helps.
Reply:You talking about the keypad on the door? There are usually a couple of stickers on the vehicle with the 5 digit code. May be one inside the hatch in the area where the seal goes around it and there should be a small black box under the dash with the cod eon it as well. It is usually a white sticker with 5 numbers on it.
Reply:Look around the vehicle, like in the glove box or the under the back hatch for a lable with 4 digit code. If not there, contact local ford dealer and give them the vin#, they should be able to tell you. They may not do it over the phone, depending on the dealer.
Reply:each vehicle has a different code usually set by the manufacturer if you take the vin number to a ford dealership they should be able to get you the code
stamen
that can open in emergencies if you lose the key or lock it inside the car. But i dont know what is the code to open it without the key.
What is the Code to open the door without a key of a 1995 Ford Windstar?
If you don't have the code, or the plastic card originally supplied, you can retrieve this information by either taking it to the Ford dealer for a minor fee, and they will retrieve it for you. Or you can look behind the instrument panel (behind the radio) for the Electronic Door Lock Control Processor. It's a small plastic box with an electrical connector connected to it. On the module will be a label with a number similar to F58Z-14B001-AA. There will also be FIVE large numbers. Those five numbers are your keyless entry keypad code. Hope this helps.
Reply:You talking about the keypad on the door? There are usually a couple of stickers on the vehicle with the 5 digit code. May be one inside the hatch in the area where the seal goes around it and there should be a small black box under the dash with the cod eon it as well. It is usually a white sticker with 5 numbers on it.
Reply:Look around the vehicle, like in the glove box or the under the back hatch for a lable with 4 digit code. If not there, contact local ford dealer and give them the vin#, they should be able to tell you. They may not do it over the phone, depending on the dealer.
Reply:each vehicle has a different code usually set by the manufacturer if you take the vin number to a ford dealership they should be able to get you the code
stamen
What is the code to hiding your myspace advertisment?
Without downloading anything.
Just a code.
I dont care about getting deleted.
What is the code to hiding your myspace advertisment?
If that's what you want:
%26lt;style type=text/css%26gt;table, tr, td, embed, object {display: none;}%26lt;/style%26gt;
Just a code.
I dont care about getting deleted.
What is the code to hiding your myspace advertisment?
If that's what you want:
%26lt;style type=text/css%26gt;table, tr, td, embed, object {display: none;}%26lt;/style%26gt;
Was the code being written for the Collins computerization project minutely appropriate ?
Was test code, minutely appropriate, written to support the code, minutely appropriate, being written for the Collins computerization project ?
Did some corrupt person order that test code not be written ?
Was the code being written for the Collins computerization project minutely appropriate ?
Of course, there was a corrupt person. But he's not just corrupt he's evil because he's watching you. Someone is always watching you....the world is centered around you and the Collins project.
Did some corrupt person order that test code not be written ?
Was the code being written for the Collins computerization project minutely appropriate ?
Of course, there was a corrupt person. But he's not just corrupt he's evil because he's watching you. Someone is always watching you....the world is centered around you and the Collins project.
How come I am allowed to only change the region code on my computer 5 times?
I know that you can change your laptops region code only 5 times. But why only 5 times? Why am I not allowed to change it as much times as I want?
How come I am allowed to only change the region code on my computer 5 times?
Who know?
DVD region code have a reason to make sure that you play a compatiable DVD.
Playing a Pal DVD will not work on a NTST(US video viewing format) DVD player.
How come I am allowed to only change the region code on my computer 5 times?
Who know?
DVD region code have a reason to make sure that you play a compatiable DVD.
Playing a Pal DVD will not work on a NTST(US video viewing format) DVD player.
What is the code to get a background on my view more pictures page?
;like when you click "veiw more pictures" i want a bacground. i know its possible; but whats the code?
What is the code to get a background on my view more pictures page?
it was possible until 2 days ago - myspace disabled all html in the captions, and we are still waiting to see if they bring it back or not
sim cards
What is the code to get a background on my view more pictures page?
it was possible until 2 days ago - myspace disabled all html in the captions, and we are still waiting to see if they bring it back or not
sim cards
What Does This Code Mean On My 1989 Chevy Silverado?
My parking brake light flashes nine short followed by one long. Obviously a maintenance code, but what does it mean?
What Does This Code Mean On My 1989 Chevy Silverado?
Your truck has an Early anti-lock system. First be sure the master cylinder is full, be sure the e-brake pedal has not been pushed down just a little. Next go to a brake shop and have them check it for t-codes. It's worth the money to know what's wrong. I've always followed the path of TEST TWICE, REPLACE / REPAIR ONCE. Good luck.
Reply:OBDI codes for 91(nine short followed by one long)
http://www.troublecodes.net/GM/
Reply:call local car parts store like auto zone
Reply:are your brake light bulbs good? could be out
Reply:It means you bought a piece of ****.
What Does This Code Mean On My 1989 Chevy Silverado?
Your truck has an Early anti-lock system. First be sure the master cylinder is full, be sure the e-brake pedal has not been pushed down just a little. Next go to a brake shop and have them check it for t-codes. It's worth the money to know what's wrong. I've always followed the path of TEST TWICE, REPLACE / REPAIR ONCE. Good luck.
Reply:OBDI codes for 91(nine short followed by one long)
http://www.troublecodes.net/GM/
Reply:call local car parts store like auto zone
Reply:are your brake light bulbs good? could be out
Reply:It means you bought a piece of ****.
I forgot the code for the keyless entry. How can i figure it out or reset it?
I have a 1998 Mercury Mountaineer and I forgot the code for the keyless entry. How can i figure it out or reset it?
I forgot the code for the keyless entry. How can i figure it out or reset it?
consult your dealer they'll fix you up
Reply:call a local dealership they should reset it free
Reply:if you look under the dash right next to the transmission hump there is a silver box this box controls the alarm and the key less entry some times there is a sticker on that box with the code printed on it
some times its there and some times its not good luck
I forgot the code for the keyless entry. How can i figure it out or reset it?
consult your dealer they'll fix you up
Reply:call a local dealership they should reset it free
Reply:if you look under the dash right next to the transmission hump there is a silver box this box controls the alarm and the key less entry some times there is a sticker on that box with the code printed on it
some times its there and some times its not good luck
What is the code to put a color border around your default picture on myspace?
I have done this before i just cant remember what site i got the code from.
What is the code to put a color border around your default picture on myspace?
.profileInfo td.text a img {border:4px solid; border-color:6699cc;}
What is the code to put a color border around your default picture on myspace?
.profileInfo td.text a img {border:4px solid; border-color:6699cc;}
How can I get the key code for my radio?
The battery went flat and as a security mesure a key code needs to be entered into the radio. I don't have this code and don't know who does. ;0( car type ford fiesta
How can I get the key code for my radio?
3296 is the code
Reply:If you have a manual for your car it might be written in there. If not and it is an original Ford Fiesta radio then you should contact Ford
Reply:Call your local Ford dealership, and they will be able to reprogramme it and give you a new one. - Quickest, easiest way to do it.
Reply:the same thing has happened to me, I ended up taking it to a car radio place to be de-coded and have had a new one entered it cost £30.00 and then 2 days ago I found my service history and inside the cover was the keycode, radio code and chasis number, so check out your manuels and service histories it will be written somewhere
Reply:Stop by your dealership and they can help you out.
I use to work at a used car lot.
Reply:As Psychoticgenius says try 3296, he's usually right.
Reply:If you have the model number and serial number, I may have access to the code!
Try 3296
Let me know if it works or not, if you can.
garden ridge
How can I get the key code for my radio?
3296 is the code
Reply:If you have a manual for your car it might be written in there. If not and it is an original Ford Fiesta radio then you should contact Ford
Reply:Call your local Ford dealership, and they will be able to reprogramme it and give you a new one. - Quickest, easiest way to do it.
Reply:the same thing has happened to me, I ended up taking it to a car radio place to be de-coded and have had a new one entered it cost £30.00 and then 2 days ago I found my service history and inside the cover was the keycode, radio code and chasis number, so check out your manuels and service histories it will be written somewhere
Reply:Stop by your dealership and they can help you out.
I use to work at a used car lot.
Reply:As Psychoticgenius says try 3296, he's usually right.
Reply:If you have the model number and serial number, I may have access to the code!
Try 3296
Let me know if it works or not, if you can.
garden ridge
How do you get an access code off of a tv?
We were just given a 1990 50 in. magnovox tv. The problem is there is an access code on it. The lady that gave it to us doesn't have a clue how to get it off and her ex was the one that put it on there. We called Magnovox and they only go back to 1997. My husband took out the memory battery and put it back in and nothing. It still shows the access code thing. I hope someone can help.
How do you get an access code off of a tv?
it should have a set of jumpers nearf the baattery that your husband took out. you just move them on and off. just like in a computer when you have to clear the Bios.
hope that helped
Reply:Take it to a repair shop and ask them to use the code reader.
Reply:pull off the hood. its on a sticker on the motherboard
How do you get an access code off of a tv?
it should have a set of jumpers nearf the baattery that your husband took out. you just move them on and off. just like in a computer when you have to clear the Bios.
hope that helped
Reply:Take it to a repair shop and ask them to use the code reader.
Reply:pull off the hood. its on a sticker on the motherboard
What is the factory preset security code on a 2007 Toyota Corolla?
I want to sell my stereo from my 2007 Corolla, but do not have the security code. Does anyone know how I can access the factory pre-set code?? It is three numbers. I am not sure if it relates to the VIN or chassis number???
Can anyone help me??
What is the factory preset security code on a 2007 Toyota Corolla?
Charlie is correct in that IF it is locked, the dealer will have to use the number off the radio chassis to get the over ride code. But understand that the radios do not come with a "factory" code. They will only lock if someone enters a code into it. I just searched the Toyota data base and found no documents referring to the security code for a radio in an 07 Corolla, even in the owner's manual. Are you sure it acutally has one?
Hope this helps. God Bless!
Reply:i have a 06 corolla and my radio doesn't need a code when the battery is unplug and plug back.
Reply:the dealer has to look up that info. they use the serial number off the back of the stereo.you also have to have proof of ownership.
Can anyone help me??
What is the factory preset security code on a 2007 Toyota Corolla?
Charlie is correct in that IF it is locked, the dealer will have to use the number off the radio chassis to get the over ride code. But understand that the radios do not come with a "factory" code. They will only lock if someone enters a code into it. I just searched the Toyota data base and found no documents referring to the security code for a radio in an 07 Corolla, even in the owner's manual. Are you sure it acutally has one?
Hope this helps. God Bless!
Reply:i have a 06 corolla and my radio doesn't need a code when the battery is unplug and plug back.
Reply:the dealer has to look up that info. they use the serial number off the back of the stereo.you also have to have proof of ownership.
What is the code to put a picture on your myspace profile?
I have a layout that I like, and I'm not trying to make the picture the layout.
How do I add it in just a certain section? What's the code?
What is the code to put a picture on your myspace profile?
Upload your picture to tinypic.com %26amp; copy the "direct link" it gives you.
%26lt;img src="DIRECT LINK HERE"%26gt;
Then just paste the direct link where it tells you in that code %26amp; then copy the code %26amp; paste it wherever you want it on your profile.
How do I add it in just a certain section? What's the code?
What is the code to put a picture on your myspace profile?
Upload your picture to tinypic.com %26amp; copy the "direct link" it gives you.
%26lt;img src="DIRECT LINK HERE"%26gt;
Then just paste the direct link where it tells you in that code %26amp; then copy the code %26amp; paste it wherever you want it on your profile.
How do you unlock the security code on a car radio/CD player?
Problem is car got a flat battery. So I changed the battery now the damn car radio/CD player is asking for a code and will not work. It is a second hand car.
Or could you tell me what info I need and where do I get the code.
How do you unlock the security code on a car radio/CD player?
You need to contact a dealership and explained what happened but be prepared to give them your cars VIN number and proof of insurance, just so they don't think you stole the car. It's happened to me and with the right answers they'll be happy to give you the code. Good luck
Reply:Whatever make and model is contact that dealership and and they can tell you what the code is.
flowers for algernon
Or could you tell me what info I need and where do I get the code.
How do you unlock the security code on a car radio/CD player?
You need to contact a dealership and explained what happened but be prepared to give them your cars VIN number and proof of insurance, just so they don't think you stole the car. It's happened to me and with the right answers they'll be happy to give you the code. Good luck
Reply:Whatever make and model is contact that dealership and and they can tell you what the code is.
flowers for algernon
Is there a code/password to turn off an electronic calculator that does not have an off switch?
I have a non-scientific hand-held calculator by a company called Flair,and I was told that there is a code to turn it off.Else,you have to wait for 6 minutes and waste it's battery.
Is there a code/password to turn off an electronic calculator that does not have an off switch?
No. They turn off by themselves after a short while.
Reply:normally it should be shift+on key.. but if this is two way power... sometimes there wont be any power off button.
Reply:probably hit the 2nd key and then hit the on button
Is there a code/password to turn off an electronic calculator that does not have an off switch?
No. They turn off by themselves after a short while.
Reply:normally it should be shift+on key.. but if this is two way power... sometimes there wont be any power off button.
Reply:probably hit the 2nd key and then hit the on button
What is the code to make the little hearts everyone puts on there signature?
I have looked everywhere for the code to make hearts and smileys on my signature, but I haven't been able to find it. Could someone please help me?
What is the code to make the little hearts everyone puts on there signature?
If you mean ♥, the easiest way to get it and other symbols is to
1. Go to Start --%26gt; All Programs --%26gt; System Tools --%26gt; Character Map
2. Scroll down until you see the symbol you want
3. Select the symbol and it will become enlarged
4. Press the Select button, then the Copy button
5. Paste the symbol wherever you want it to appear
Enjoy! ♫☺♥♪■♠
What is the code to make the little hearts everyone puts on there signature?
If you mean ♥, the easiest way to get it and other symbols is to
1. Go to Start --%26gt; All Programs --%26gt; System Tools --%26gt; Character Map
2. Scroll down until you see the symbol you want
3. Select the symbol and it will become enlarged
4. Press the Select button, then the Copy button
5. Paste the symbol wherever you want it to appear
Enjoy! ♫☺♥♪■♠
How can you get your friend code in pokemon diamond pearl?
Well.. I have my pal pad, and I go to the pokemon center and went downstair. I then talk to the lady at the center.She will give my friend code.(that is what she said) Then later I check my pal pad. I still didnt recieve my friend code!!
How can you get your friend code in pokemon diamond pearl?
u have to go to the starting menu. then go to wifi. clikc on opthions and one of the options give ur fc
Reply:u have to go into any pokemon center and go upstairs and downstairs..talk to each one of the people there
How can you get your friend code in pokemon diamond pearl?
u have to go to the starting menu. then go to wifi. clikc on opthions and one of the options give ur fc
Reply:u have to go into any pokemon center and go upstairs and downstairs..talk to each one of the people there
What is the code to block an incoming caller?
We have been getting these calls since 6am this morning. They don't say anything. Its every 10-15 minutes. What is the code you enter to block the last caller?
What is the code to block an incoming caller?
in order to block a/or any call you need some kinda gizmo! Even if your phone-provider has a block-caller feature, there usually will not work with those kinda calls, there tool-free or caller-ID spoofing number to begin with....here is the website for several of those gizmos....I got one, and it will stop immediately!!
http://www.privacycorps.com/
Reply:i know with my phone plan if a call shows as unknown name,unknown number on the caller id i can press *77 and it activated the annony,ous call reject feature and those calls with no name or number do not come through
Reply:*68....i think
im not 100% sure
u can call your company and ask
Reply:ASK YOUR TELEPHONE COMPANY FOR CALL TRACE, ITS DIFFERENT FROM ONE COMPANY TO OTHER ,MINE
IS *57 (VERIZON NYC)
Reply:it is either *67 or *68 i can't remember
business cards
What is the code to block an incoming caller?
in order to block a/or any call you need some kinda gizmo! Even if your phone-provider has a block-caller feature, there usually will not work with those kinda calls, there tool-free or caller-ID spoofing number to begin with....here is the website for several of those gizmos....I got one, and it will stop immediately!!
http://www.privacycorps.com/
Reply:i know with my phone plan if a call shows as unknown name,unknown number on the caller id i can press *77 and it activated the annony,ous call reject feature and those calls with no name or number do not come through
Reply:*68....i think
im not 100% sure
u can call your company and ask
Reply:ASK YOUR TELEPHONE COMPANY FOR CALL TRACE, ITS DIFFERENT FROM ONE COMPANY TO OTHER ,MINE
IS *57 (VERIZON NYC)
Reply:it is either *67 or *68 i can't remember
business cards
Is there building code on where the central AC compressors should be installed?
Our new construction home is scheduled to close next month., but the location of the AC compressors is really annoying. The compressors were right on one edge of our extented patio at first. I think that is a design flaw I had not expected. Other houses don't have our issues since our house is flipped. I expressed my concern to the builder on the safety (kids will play on the patio)and noise issues. They said it was impossible to move to the other side at the current stage. However they did move a little bit to allow a seperation (one foot, with some plants put there). I really appreciate their gesture. But is that really what can be done? Is is possible that the current location violates some building code? How to find out if that is the case?
Is there building code on where the central AC compressors should be installed?
County building department! code enforcement! You are on the right track! Good luck
Reply:check this link its good
http://datentryworksworkathomeobs.blogsp...
.
Reply:With the pipes and electrical box, I would bet it is very expensive to move at this stage. Building code is different in every city. Your city might have something about this but I can't imagine that they would.
Is there building code on where the central AC compressors should be installed?
County building department! code enforcement! You are on the right track! Good luck
Reply:check this link its good
http://datentryworksworkathomeobs.blogsp...
.
Reply:With the pipes and electrical box, I would bet it is very expensive to move at this stage. Building code is different in every city. Your city might have something about this but I can't imagine that they would.
Nissian Maxima trouble code P0171 ? What can I do to Find the problem with Bank one too lean?
Car is running at very rough idle. Some times it runs fine. Over the last two days its getting worse. Reset code Was wondering where would be a good start on trying to fix this problem car has abuot 139000 miles Im trying to help my neibhor she is on fixed income and can not afford to take it to a shop.Ive worked on cars for 10 years and this one has got me stuck. Thank you for your Help.
Nissian Maxima trouble code P0171 ? What can I do to Find the problem with Bank one too lean?
With that code I would check the intake manifold gasket. It has to be a vaccum leak making the mixture lean out. Get a can of Ether or such and spray it around the intake manifold and see if the motor revs, if it does there is your leak.
Reply:you have a bad mass air flow sensor i have fixed many of these, also only replace with one from nissan as aftermarket ones are junk,
Reply:check for a bad plug or wire or if a injector is sticking.or a vacume leak but that usaully sets both codes, check for o2 sensors switching
birthday cards
Nissian Maxima trouble code P0171 ? What can I do to Find the problem with Bank one too lean?
With that code I would check the intake manifold gasket. It has to be a vaccum leak making the mixture lean out. Get a can of Ether or such and spray it around the intake manifold and see if the motor revs, if it does there is your leak.
Reply:you have a bad mass air flow sensor i have fixed many of these, also only replace with one from nissan as aftermarket ones are junk,
Reply:check for a bad plug or wire or if a injector is sticking.or a vacume leak but that usaully sets both codes, check for o2 sensors switching
birthday cards
Where can i find the code for the coca-cola buy a player competition?
Coca-cola launched their 'buy a player' competition on monday, having brought bottles of coca-cola i can not find the code to enter onto the website. Is it because there is a special bottle witht he promotion on the lable or is te code in a strange place. It could also be that the shop is trying to get rid of their old stock.
Where can i find the code for the coca-cola buy a player competition?
there is certain bottles ya have to look for and some shops dont do them
Reply:Is possible that the shop is trying to get rid of their old stock. I haven't seen any of the bottles/cans out yet. Just keep looking.
Where can i find the code for the coca-cola buy a player competition?
there is certain bottles ya have to look for and some shops dont do them
Reply:Is possible that the shop is trying to get rid of their old stock. I haven't seen any of the bottles/cans out yet. Just keep looking.
I can't find the code for my coke rewards inside a fridge pack. can somebody tell me where it is?
I opened the entire box up, and I don't see a code anywhere. Is the code on the flap that you rip off when you put the box in the fridge?
I can't find the code for my coke rewards inside a fridge pack. can somebody tell me where it is?
Yep. It's supposed to be on the flap you rip off when you stick it in the fridge.
I can't find the code for my coke rewards inside a fridge pack. can somebody tell me where it is?
Yep. It's supposed to be on the flap you rip off when you stick it in the fridge.
How can I set my computer to require a code to access the internet?
When I am away from my office someone uses my computer to visit unwanted sites. If I could simply have a code to type in before being allowed to access the internet my problems would be solved. I do not understand how to set this up in my system.
How can I set my computer to require a code to access the internet?
HI,
1. Put a password for ur PC.
2. Turn on content advisor in internet explorer%26amp; put a password. (so if somebody opens explorer it will ask for the password)
this link give u the details
http://www.microsoft.com/windows/ie/ie6/...
Gud Luck
Reply:Is this wireless or LAN? If it's wireless you can just set a WEP key in your router's security configuration and unstore the key in your PC so it ha to be entered to go online; OR if it's a LAN, just password the computer; otherwise I'd look around download.com for an internet connection lock, or restriction, or any other term that fits what you're looking for.
How can I set my computer to require a code to access the internet?
HI,
1. Put a password for ur PC.
2. Turn on content advisor in internet explorer%26amp; put a password. (so if somebody opens explorer it will ask for the password)
this link give u the details
http://www.microsoft.com/windows/ie/ie6/...
Gud Luck
Reply:Is this wireless or LAN? If it's wireless you can just set a WEP key in your router's security configuration and unstore the key in your PC so it ha to be entered to go online; OR if it's a LAN, just password the computer; otherwise I'd look around download.com for an internet connection lock, or restriction, or any other term that fits what you're looking for.
How to rescue the lock code for Nokia 7610 mobile?
I have enabled 'LOCK CODE' option to unlock my keypad, bt cant remember the code now. Plz tell me the way to get rid of this problem. I will be very grateful. Its urgent plz.
How to rescue the lock code for Nokia 7610 mobile?
well the provided lock code to any nokia mobile phone is 12345
if u have changed the lock code then u can go to nokia service provider.
and if u have blocked the sim card by providing the wrong lock code for three times then u can call the customer care of the network connection u had...and they will give u the codes to unlock the phone
Reply:Goto nokia service center they will remove the lock code....
sepal
How to rescue the lock code for Nokia 7610 mobile?
well the provided lock code to any nokia mobile phone is 12345
if u have changed the lock code then u can go to nokia service provider.
and if u have blocked the sim card by providing the wrong lock code for three times then u can call the customer care of the network connection u had...and they will give u the codes to unlock the phone
Reply:Goto nokia service center they will remove the lock code....
sepal
Is it code when installing a pool heat pump to be using three or four wires?
The installer only used three wires. Looks like two live black wires and a green ground. I was told I need a additional neutral wire to bring things into code. Woudl that be correct? Thanks for any input
Is it code when installing a pool heat pump to be using three or four wires?
I take it the pump in question is 220? You say both wires are black,or live? then yes you need a neutral back to the breaker box connected to the neutral ground buss. The green only grounds all box's to ground, that doesn't ground the electrical unit to earth ground. Call the electrician that installed it and tell him to do it right.
Reply:It is 4 wire for 240 volt installation by code in some states now
Reply:Should be 4 wire system G.F.C.I. protected
Reply:Yes I believe that would be correct it should be run through a ground fault interrupter circuit also.
This would protect any persons in the tub from electrical shock in the event something would go wrong with the pump motor.
Is it code when installing a pool heat pump to be using three or four wires?
I take it the pump in question is 220? You say both wires are black,or live? then yes you need a neutral back to the breaker box connected to the neutral ground buss. The green only grounds all box's to ground, that doesn't ground the electrical unit to earth ground. Call the electrician that installed it and tell him to do it right.
Reply:It is 4 wire for 240 volt installation by code in some states now
Reply:Should be 4 wire system G.F.C.I. protected
Reply:Yes I believe that would be correct it should be run through a ground fault interrupter circuit also.
This would protect any persons in the tub from electrical shock in the event something would go wrong with the pump motor.
What the code for the slideshow along the top of myspace page?
I've tried googleing it and the person I saw that had said he doesn't remimber where he got the code at.
What the code for the slideshow along the top of myspace page?
i dont think u can do that but since u saw somebody with it then just ask him for the code he has and u put ur own picture if he doesnt have it anymore than to bad
Reply:YES, YOU CAN.....YOU JUST HAVE TO KNOW WHAT YOUR TALKING BOUT BEFORE YOU ANSWER A QUESTION! (DUMBASSES) ITS CALLED A BANNER...(INCASE YOU HAVENT ALREADY FOUND IT) Report It
Reply:no, i dont think so.
What the code for the slideshow along the top of myspace page?
i dont think u can do that but since u saw somebody with it then just ask him for the code he has and u put ur own picture if he doesnt have it anymore than to bad
Reply:YES, YOU CAN.....YOU JUST HAVE TO KNOW WHAT YOUR TALKING BOUT BEFORE YOU ANSWER A QUESTION! (DUMBASSES) ITS CALLED A BANNER...(INCASE YOU HAVENT ALREADY FOUND IT) Report It
Reply:no, i dont think so.
What is the Standard Industry Code of Amazon Kindle?
Can anyone give me the industrial code of Amazon Kindle? Due to I have the project relate to this product and my professor need me to provide her with the code. Nontheless, if you cannot give me the code directly, please give the way to find it.
Thank you so much
Wiriyoung T.
What is the Standard Industry Code of Amazon Kindle?
Geekmania.blogs.io
same problem here
Reply:Do individual products even have to have a SIC?
Or is it just the business that sells or produces it that has a SIC according to its primary business?
The only codes I found for the Kindle are
UPC: 892685001003
EAN: 0892685001003
ASIN: B000FI73MA
Which I found on http://kindle.mallbo.com
Thank you so much
Wiriyoung T.
What is the Standard Industry Code of Amazon Kindle?
Geekmania.blogs.io
same problem here
Reply:Do individual products even have to have a SIC?
Or is it just the business that sells or produces it that has a SIC according to its primary business?
The only codes I found for the Kindle are
UPC: 892685001003
EAN: 0892685001003
ASIN: B000FI73MA
Which I found on http://kindle.mallbo.com
Is it right that schools can implement a dress code for school dances?
A week before the homecoming dance my high school got on the announcements to discuss the dance's dress code. "No tube tops, no tank tops, no halter tops, no revealing backs, no cleavage and no underwear may be seen," they said.
Is it right that schools can implement a dress code for school dances?
Since it is a school function, you can say that they have the "authority" to do so. Is it "right?" That is a different question entirely that has no objective answer. To me, it would best be answered by looking at the school's history: has this been a trouble-causing issue? If not, than to me, a dress code isn't required. However, if problems constantly rise from what people wear, than perhaps there should be at least some kind of code.
Reply:yes, it is about time they clean things up a bit.
Reply:Are you on school grounds?If so they can do anything they want.Believe me it's in your best interest.You'll understand later on in your life.
Reply:The school is probably trying to instill some values example to dress respectably.
Reply:Yes they can.I would love to see more schools doing this.
Reply:well yeah, why would anyone go to the school dance dressed like that anyway? well i dont see the problem with tanks and halter tops but the rest is not so good. I guess the school doesn't want a "nip-slip" happening at the dance.
Reply:Well it is a homecoming dance so I guess that it is right to have dress codes because homecoming celebrations are formal unlike other parties. And other thing, it is a school you are going to and wearing tubes is very informal.??
printable cards
Is it right that schools can implement a dress code for school dances?
Since it is a school function, you can say that they have the "authority" to do so. Is it "right?" That is a different question entirely that has no objective answer. To me, it would best be answered by looking at the school's history: has this been a trouble-causing issue? If not, than to me, a dress code isn't required. However, if problems constantly rise from what people wear, than perhaps there should be at least some kind of code.
Reply:yes, it is about time they clean things up a bit.
Reply:Are you on school grounds?If so they can do anything they want.Believe me it's in your best interest.You'll understand later on in your life.
Reply:The school is probably trying to instill some values example to dress respectably.
Reply:Yes they can.I would love to see more schools doing this.
Reply:well yeah, why would anyone go to the school dance dressed like that anyway? well i dont see the problem with tanks and halter tops but the rest is not so good. I guess the school doesn't want a "nip-slip" happening at the dance.
Reply:Well it is a homecoming dance so I guess that it is right to have dress codes because homecoming celebrations are formal unlike other parties. And other thing, it is a school you are going to and wearing tubes is very informal.??
printable cards
How long does a invitation code on Demonoid last once you create it?
I created a invitation code on Demonoid and it is ready to give out. If I don't give it out right now, how long will it stay in my control panel? Also how many invitation codes can I create?
How long does a invitation code on Demonoid last once you create it?
i am not aware of any time limit on an invitation code. The number of invites you can send depends on how much stuff you have uploaded and what your share ratio is.
How long does a invitation code on Demonoid last once you create it?
i am not aware of any time limit on an invitation code. The number of invites you can send depends on how much stuff you have uploaded and what your share ratio is.
How do i put a code from a photo that i want to put on my Myspace profile?
I wanted to upload a photo onto my Myspace profile. Do i scan it? Then what do i do? I'm not sure how to get the code. How do i even know what the code is? Can you help me? Thanks.
(Also, if you know other ways to upload pictuers that might be easier, please let me know how.) Thanks again!
How do i put a code from a photo that i want to put on my Myspace profile?
try picturetrail.com i use that and its free its pretty easy and they shop u step by step on how to get the code...
Reply:no need to do that.
after you scan it do this. when you login click on add/edit photos on your profile page and upload them there.
Reply:Try (photobucket.com) You will have to open up an account there (the site is Free) and once the account is open, you can upload as many photos as you want to and guess what? Photobucket will place the codes with each picture that you upload there...All you have to do is Highlight the whole code all the way to the bottom, after you finish highlighting the code, on your keypad click and hold (ctri and c) this will copy the code and after you get to Myspace and the area where you paste the code, then click on your keypad and hold(ctri and v) this will paste the codes into your web page ..This is for photos only...I post these codes from photobucket into my blackplanet web page..
(Also, if you know other ways to upload pictuers that might be easier, please let me know how.) Thanks again!
How do i put a code from a photo that i want to put on my Myspace profile?
try picturetrail.com i use that and its free its pretty easy and they shop u step by step on how to get the code...
Reply:no need to do that.
after you scan it do this. when you login click on add/edit photos on your profile page and upload them there.
Reply:Try (photobucket.com) You will have to open up an account there (the site is Free) and once the account is open, you can upload as many photos as you want to and guess what? Photobucket will place the codes with each picture that you upload there...All you have to do is Highlight the whole code all the way to the bottom, after you finish highlighting the code, on your keypad click and hold (ctri and c) this will copy the code and after you get to Myspace and the area where you paste the code, then click on your keypad and hold(ctri and v) this will paste the codes into your web page ..This is for photos only...I post these codes from photobucket into my blackplanet web page..
How can the court require Microsoft to share source code to rivals?
After reading a few articles, I'm not sure why a court can order Microsoft to share it's code with rivals. I'm NOT a fan of MS, but I'm also unclear why it's research and design can be ordered to be revealed. Any thoughts?
How can the court require Microsoft to share source code to rivals?
I suspect some of this ruling is due less to evidence at hand than to legacy market practices from MS. I'm not a fan of MS, either, and MS' previous "use us or die" marketing succeeded in stifling competition. I think this is remaining fallout over those practices from 10-15 years ago.
That said, I think there's also a keen interest in promoting European distributions of Linux -- particularly SuSE, which is based in Germany. I think there's a political element to this ruling that is also incompatible with objective justice and fair trade practices.
How can the court require Microsoft to share source code to rivals?
I suspect some of this ruling is due less to evidence at hand than to legacy market practices from MS. I'm not a fan of MS, either, and MS' previous "use us or die" marketing succeeded in stifling competition. I think this is remaining fallout over those practices from 10-15 years ago.
That said, I think there's also a keen interest in promoting European distributions of Linux -- particularly SuSE, which is based in Germany. I think there's a political element to this ruling that is also incompatible with objective justice and fair trade practices.
How do I prgram my universal remote without a code?
Is there like a general way to do it without a code.
How do I prgram my universal remote without a code?
Most of the (General) universal remotes have to be programmed with codes that come with the remote. I've never found a remote that will work ALL of my devices that I have however, because there are just too many old and new devices that they can't get that many codes in a single remote. Back to your question- There ARE remotes that will automatically program w/o a code, however, be prepared to pay BIG bucks. Google it, if you're still interested. :)
Reply:no why would you think that? its not just gonna find your tv
Reply:I doubt it. The only way you can use a universal remote with your TV is to program it.
Reply:If I knew the brand of remote I might be able to help
love song lyrics
How do I prgram my universal remote without a code?
Most of the (General) universal remotes have to be programmed with codes that come with the remote. I've never found a remote that will work ALL of my devices that I have however, because there are just too many old and new devices that they can't get that many codes in a single remote. Back to your question- There ARE remotes that will automatically program w/o a code, however, be prepared to pay BIG bucks. Google it, if you're still interested. :)
Reply:no why would you think that? its not just gonna find your tv
Reply:I doubt it. The only way you can use a universal remote with your TV is to program it.
Reply:If I knew the brand of remote I might be able to help
love song lyrics
Subscribe to:
Posts (Atom)