Please tell me the code to play midi or wav file on a web site. Or a site where I can copy and add the code myself. Thanks
How do I write the code for a midi file to play music on a web site?
If you are simply using basic HTML on your website, then the format can be %26lt;BGSOUND SRC="YourMusicFileHere.wav" LOOP="1"%26gt; .... your music file should also be on the same folder as your html pages or you need to specify the location, the loop can also be manipulated depending on how many times you would want it to play. If you want to add music on a flash website, there are lots of methods how, here is one;
http://www.premiumbeat.com/flash_resourc...
Just follow the steps. They have provided the swf for the player already, you only need to upload you music files on your domain and direct in on the embed tag.
Sunday, August 2, 2009
How do I make or code an online machine translator?
I'd like to use one to make a 'code' my friends and I can decipher, Ie, our own 'language' that we can run through one. So, does anyone know how to program an online machine translator?
How do I make or code an online machine translator?
May be you can contact a web developer at website like http://definitivelab.com/ .
How do I make or code an online machine translator?
May be you can contact a web developer at website like http://definitivelab.com/ .
What is the default security code for a Nokia 2126 Tracfone?
A friend of mine just bought a Nokia 2126 Tracfone. He wants to restrict the calls on it but can't find the default security code. Does anyone know it?
What is the default security code for a Nokia 2126 Tracfone?
willowkarr@msn.com
Reply:1234, 0000, or the last 4 digits of your cell phone number are often the usual security codes
Reply:it should be the last digits of the phone number by default.
What is the default security code for a Nokia 2126 Tracfone?
willowkarr@msn.com
Reply:1234, 0000, or the last 4 digits of your cell phone number are often the usual security codes
Reply:it should be the last digits of the phone number by default.
What does this work dress code description mean?
The dress code for my new job is described as "somewhat casual but neat " what does this mean? I'm going to b e work in a bio lab if this helps?
What does this work dress code description mean?
I think it means no jeans, t-shirts, or athletic shoes even if they are new and clean. I think they mean chinos or khakis for trousers, a shirt with a collar (Polo shirt or sport shirt), leather casual shoes and dark socks. You can't go wrong with that to start. After a few weeks, you'll get a better feel for what they mean. Observe what the supervisors and star performers wear, and you probably won't go wrong.
Reply:I would take this to mean no jeans. If you're a guy, I'd wear nice pants like Dockers and a dress shirt or polo shirt. If you're a woman, I'd wear nice pants and casual tops, either button down or pullover -- no spaghetti straps or tank tops. Look professional, but not like you're about to step into a meeting.
Reply:Casual typically refers to slacks, such as Dockers or similar type pants. Button down blouses, not pull over T shirts that show the midriff. Comfortable shoes, not open toe sandals or heels.
Reply:With a description like that, I would start with casual dress pants like Dockers and a button down or polo-type shirt. If you notice people wearing jeans, then go with that. Neat would imply no stained, torn, ripped, or badly wrinkled clothing regardless of jeans or Dockers.
Reply:That sounds like dressy casual to me.
Guys: kacki pants and shirt. No tie.
girls: slacks and shirt with flats. No need for stockings or heels. No ragged bluejeans or middie shirts. No t-shirts with sayings.
Reply:It could mean jeans is good condition and no collared shirt, or nice pants and a collared shirt, or anything in between.
Best bet is to call HR and ask them. That's what they get paid for. :)
Reply:Means you don't need to wear a tie but a shirt will do.Also dress pant in cotton would be okay.Of course ,all dresses are required to be neat so don't wear the same thing without washing it.Since you work at a lab some sort of coat must be necessary for you to wear that's why casual wear will be comfortable rather than formal.
Reply:My guess would be to wear something along the line of Dockers.
Reply:casual as in you dont have to dress up too much you can wear normal clothes like pants or shorts but you cant come in wearing torn shorts and pants and stained shirts etc.
Reply:This means that you don't have to wear formal business clothes, but they should be in good condition, as should your body. Just make sure that you are clean, your hair has a neat appearance (and, if long, is tied back in a tight ponytail), and you aren't wearing stained shirts or torn jeans. In bio labs, there are sometimes dangerous chemicals or biohazards, and employers generally don't want much skin exposed. A nice, clean, long-sleeved shirt with long pants and closed-toed shoes is probably your best option.
Reply:A pair of Dockers or kakhi's and a nice shirt or sweater.
Reply:I think it means khakis, button shirts, loafers, etc.; no holes, no wrinkles. No t-shirts, shorts, or flip-flops. Just look at what others are wearing, you will get the idea very quickly.
Reply:it means that you could wear a sweater or a nice top with a descent pair of jeans
stamen
What does this work dress code description mean?
I think it means no jeans, t-shirts, or athletic shoes even if they are new and clean. I think they mean chinos or khakis for trousers, a shirt with a collar (Polo shirt or sport shirt), leather casual shoes and dark socks. You can't go wrong with that to start. After a few weeks, you'll get a better feel for what they mean. Observe what the supervisors and star performers wear, and you probably won't go wrong.
Reply:I would take this to mean no jeans. If you're a guy, I'd wear nice pants like Dockers and a dress shirt or polo shirt. If you're a woman, I'd wear nice pants and casual tops, either button down or pullover -- no spaghetti straps or tank tops. Look professional, but not like you're about to step into a meeting.
Reply:Casual typically refers to slacks, such as Dockers or similar type pants. Button down blouses, not pull over T shirts that show the midriff. Comfortable shoes, not open toe sandals or heels.
Reply:With a description like that, I would start with casual dress pants like Dockers and a button down or polo-type shirt. If you notice people wearing jeans, then go with that. Neat would imply no stained, torn, ripped, or badly wrinkled clothing regardless of jeans or Dockers.
Reply:That sounds like dressy casual to me.
Guys: kacki pants and shirt. No tie.
girls: slacks and shirt with flats. No need for stockings or heels. No ragged bluejeans or middie shirts. No t-shirts with sayings.
Reply:It could mean jeans is good condition and no collared shirt, or nice pants and a collared shirt, or anything in between.
Best bet is to call HR and ask them. That's what they get paid for. :)
Reply:Means you don't need to wear a tie but a shirt will do.Also dress pant in cotton would be okay.Of course ,all dresses are required to be neat so don't wear the same thing without washing it.Since you work at a lab some sort of coat must be necessary for you to wear that's why casual wear will be comfortable rather than formal.
Reply:My guess would be to wear something along the line of Dockers.
Reply:casual as in you dont have to dress up too much you can wear normal clothes like pants or shorts but you cant come in wearing torn shorts and pants and stained shirts etc.
Reply:This means that you don't have to wear formal business clothes, but they should be in good condition, as should your body. Just make sure that you are clean, your hair has a neat appearance (and, if long, is tied back in a tight ponytail), and you aren't wearing stained shirts or torn jeans. In bio labs, there are sometimes dangerous chemicals or biohazards, and employers generally don't want much skin exposed. A nice, clean, long-sleeved shirt with long pants and closed-toed shoes is probably your best option.
Reply:A pair of Dockers or kakhi's and a nice shirt or sweater.
Reply:I think it means khakis, button shirts, loafers, etc.; no holes, no wrinkles. No t-shirts, shorts, or flip-flops. Just look at what others are wearing, you will get the idea very quickly.
Reply:it means that you could wear a sweater or a nice top with a descent pair of jeans
stamen
Does anybody know a promotion code for Spaceslide?
I am looking to order some wardrobe fittings from them and notice they have a place for a Promotional Discount Code. Can you help?
Does anybody know a promotion code for Spaceslide?
what your asking for seems dishonest.
sincerely,
your conscience
Reply:Dishonest? it is the company themselves who've provided a space for a promotional code. I think it shows initiative! If anybody has a code it would be much appreciated by me as well as the slug.
Does anybody know a promotion code for Spaceslide?
what your asking for seems dishonest.
sincerely,
your conscience
Reply:Dishonest? it is the company themselves who've provided a space for a promotional code. I think it shows initiative! If anybody has a code it would be much appreciated by me as well as the slug.
What is a good motto for a Knight who is honored the code of chivalry?
What is a good motto for a Knight who is honored the code of chivalry? I need this because i have to do a project and i need to turn it in by next friday and i need a motto.
What is a good motto for a Knight who is honored the code of chivalry?
Deus vult! - God wills it! (Slogan of the Crusades)
Fabricati diem - Make my day
Custos morum - Guardian of morals
amor patriae - Love of country
volens et valens - wiilling and valiant)
acta non verba - Action not words
Facta, non verba - Deeds, not words. (Actions speak louder than words)
Decrevi - I have decreed
audio, video, disco - I hear, I see, I learn
vincere aut mori - conquer or die
Carpe Cerevisi - Seize the beer!
Carpe diem - Seize the day. (opportunity) (Horace)
Reply:Below I found a good website that quotes knight sayings. I liked this one.
You who long for the Knightly Order,
It is fitting you should lead a new life;
Devoutly keeping watch in prayer,
Fleeing from sin, pride and villainy;
The Church defending,
The Widows and Orphans succouring.
Be bold and protect the people,
Be loyal and valiant, taking nothing from others.
Thus should a Knight rule himself.
He should be humble of heart and always work,
And follow Deeds of Chivalry.;
Be loyal in war and travel greatly;
He should frequent tourneys and joust for his Lady Love;
He must keep honor with all,
So that he cannot be held to blame.
No cowardice should be found in his doings,
Above all, he should uphold the weak,
Thus should a Knight rule himself.
— Eustace Deschamps
Check it out
Reply:All of these are vows of the knights, and the code...any variation would do well as a motto:
To fear God and maintain His Church
To serve the liege lord in valor and faith
To protect the weak and defenseless
To give succor to widows and orphans
To refrain from the wanton giving of offense
To live by Honor and for glory
To despise pecuniary reward
To fight for the welfare of all
To obey those placed in authority
To guard the Honor of fellow knights
To eschew unfairness, meanness and deceit
To keep faith
At all times to speak the truth
To persevere to the end in any enterprise begun
To respect the Honor of women
Never to refuse a challenge from an equal
Never to turn the back upon a foe
What is a good motto for a Knight who is honored the code of chivalry?
Deus vult! - God wills it! (Slogan of the Crusades)
Fabricati diem - Make my day
Custos morum - Guardian of morals
amor patriae - Love of country
volens et valens - wiilling and valiant)
acta non verba - Action not words
Facta, non verba - Deeds, not words. (Actions speak louder than words)
Decrevi - I have decreed
audio, video, disco - I hear, I see, I learn
vincere aut mori - conquer or die
Carpe Cerevisi - Seize the beer!
Carpe diem - Seize the day. (opportunity) (Horace)
Reply:Below I found a good website that quotes knight sayings. I liked this one.
You who long for the Knightly Order,
It is fitting you should lead a new life;
Devoutly keeping watch in prayer,
Fleeing from sin, pride and villainy;
The Church defending,
The Widows and Orphans succouring.
Be bold and protect the people,
Be loyal and valiant, taking nothing from others.
Thus should a Knight rule himself.
He should be humble of heart and always work,
And follow Deeds of Chivalry.;
Be loyal in war and travel greatly;
He should frequent tourneys and joust for his Lady Love;
He must keep honor with all,
So that he cannot be held to blame.
No cowardice should be found in his doings,
Above all, he should uphold the weak,
Thus should a Knight rule himself.
— Eustace Deschamps
Check it out
Reply:All of these are vows of the knights, and the code...any variation would do well as a motto:
To fear God and maintain His Church
To serve the liege lord in valor and faith
To protect the weak and defenseless
To give succor to widows and orphans
To refrain from the wanton giving of offense
To live by Honor and for glory
To despise pecuniary reward
To fight for the welfare of all
To obey those placed in authority
To guard the Honor of fellow knights
To eschew unfairness, meanness and deceit
To keep faith
At all times to speak the truth
To persevere to the end in any enterprise begun
To respect the Honor of women
Never to refuse a challenge from an equal
Never to turn the back upon a foe
Is 190 proof Nirvana, and will having it (nirvana) get the zip code to it?
I know someone (well I do NOT know them, I running for office, so you know how it is, they are a good friend of mine, heeeheee)
and they need the zip code to Nirvana, I say 190 Proof will get you it, (gotta get those votes ya know),
WILL IT?
Thank you for your support!
(now answer the question please!)
Is 190 proof Nirvana, and will having it (nirvana) get the zip code to it?
http://www.nirvanaclub.com/index.php?sc=...
I am confused also my dear, I just saw your lovely avatar and just had to say hello, my beauty.
I hope the link help.
Perhaps, it is just so nice to see you today.
Reply:I am so confused!!
Reply:Nirvana is a mythological place of ecstasy my lovely.
and they need the zip code to Nirvana, I say 190 Proof will get you it, (gotta get those votes ya know),
WILL IT?
Thank you for your support!
(now answer the question please!)
Is 190 proof Nirvana, and will having it (nirvana) get the zip code to it?
http://www.nirvanaclub.com/index.php?sc=...
I am confused also my dear, I just saw your lovely avatar and just had to say hello, my beauty.
I hope the link help.
Perhaps, it is just so nice to see you today.
Reply:I am so confused!!
Reply:Nirvana is a mythological place of ecstasy my lovely.
How can I make my own telephone area code?
I am making a fake country and need an area code for my capital city how do I get an area code for myself that is actually functional for me.
How can I make my own telephone area code?
You can't.
sim cards
How can I make my own telephone area code?
You can't.
sim cards
How do i obtain copyright for my source code?
I have done few projects based on .NET technology. I suspect few members of my project team using the source code written by me for their personal profit. I want to obtain a copyright of my source code. I am an Indian. What should I do? Plz help me!
How do i obtain copyright for my source code?
Do you live in India?
If so you need an attorney to file - now you know what it feels like to be in the music and movie business....
Reply:by writing the code, you automatically have the copyright of the code. no one else can take it from you. (i don't know specifics about indian law, but this is a worldwide rule).
there's the exception, if you're writing code for a company. then the company is the copyright owner, and not you.
if you have the copyright to code which they are using, you can of course tell them to stop - in this case, a lawyer might be helpful.
How do i obtain copyright for my source code?
Do you live in India?
If so you need an attorney to file - now you know what it feels like to be in the music and movie business....
Reply:by writing the code, you automatically have the copyright of the code. no one else can take it from you. (i don't know specifics about indian law, but this is a worldwide rule).
there's the exception, if you're writing code for a company. then the company is the copyright owner, and not you.
if you have the copyright to code which they are using, you can of course tell them to stop - in this case, a lawyer might be helpful.
How do I get the code for my myspace musicplayer?
I want the code so i could promote my music!
How do I get the code for my myspace musicplayer?
If you embed your band profile player anywhere other than your profile, Myspace will delete your account.
Reply:just go make a myspace music profile and upload ur songs
How do I get the code for my myspace musicplayer?
If you embed your band profile player anywhere other than your profile, Myspace will delete your account.
Reply:just go make a myspace music profile and upload ur songs
What do i have to write in the place of bluetooth pass code?
İ read the manual of my new mobile and it sais i have to write it once only. Do i have to write my pin code or what?
What do i have to write in the place of bluetooth pass code?
When pairing a bluetooth device to a phone, you have to enter the pass code for secure connections. They are usually defaulted to 0000 for Motorola. Once you enter this passcode, you will not have to re-enter the passcode unless you re-pair the device to the phone.
What do i have to write in the place of bluetooth pass code?
When pairing a bluetooth device to a phone, you have to enter the pass code for secure connections. They are usually defaulted to 0000 for Motorola. Once you enter this passcode, you will not have to re-enter the passcode unless you re-pair the device to the phone.
What is your pokemon diamond or pearl friend code?
What is your pokemon diamond or pearl friend code?
My name is corley and friend code is 1762 1040 3346. Is your wifi working right now on it?
What is your pokemon diamond or pearl friend code?
Name:Chris
FC:3608 9727 0273
ill trade or battle you hit me up if your interested!
Reply:hey im jay and my fc is 0473-4511-1392 im on right now
Reply:No Its not working Me neither!!! thats Weird!!
garden ridge
My name is corley and friend code is 1762 1040 3346. Is your wifi working right now on it?
What is your pokemon diamond or pearl friend code?
Name:Chris
FC:3608 9727 0273
ill trade or battle you hit me up if your interested!
Reply:hey im jay and my fc is 0473-4511-1392 im on right now
Reply:No Its not working Me neither!!! thats Weird!!
garden ridge
What does the two letter code mean on Harper & Brothers copyright pages?
I collect Edna St. Vincent Millay First Editions, and there is always a two letter "code" like D-O, or M-K and I havent had much luck finding out the significance.
What does the two letter code mean on Harper %26amp; Brothers copyright pages?
I don't know, but I know a website with quite a few publishing professionals who probably do.
Consider joining AbsoluteWrite.com just to ask. That's where I learned what the string of numbers on the copyright page means--I've wondered that for years.
If that's too much bother, I believe AbeBooks might have a Q%26amp;A page. I've heard the site is excellent but haven't really explored it.
What does the two letter code mean on Harper %26amp; Brothers copyright pages?
I don't know, but I know a website with quite a few publishing professionals who probably do.
Consider joining AbsoluteWrite.com just to ask. That's where I learned what the string of numbers on the copyright page means--I've wondered that for years.
If that's too much bother, I believe AbeBooks might have a Q%26amp;A page. I've heard the site is excellent but haven't really explored it.
Can anyone give me a code to install The sims 2 fashion stuff?
I just bought the cd and i don't have code so i can install it.
Can anyone give me a code to install The sims 2 fashion stuff?
All of the Sims2 games come with serial numbers for installation. Check either the back of the case or the back top of the instruction booklet for the serial number. If you still don't have one, you can contact EA Games, with proof of purchase and store receipt, and request a serial number.
Reply:The code is on the back of the booklet that comes with the game. If you bought it used contact the seller and ask them for the booklet. Otherwise you're out of luck.
Reply:the code should be on the back of the hand book that came with the game. If the game didn't come with a hand book then take back to the place you bought it from. I would also contact ea games. You will not get a code from the internet that will work because all cd's have a special code for it to run, if the code doesn't match on the cd it won't run. Your best bet is to take it back.
Reply:The game should come with a code, I know this as I have it myself. If you bought it from a known shop then take it back and ask to replace it, if you bought it from someone second hand etc, then it's your own fault.
Can anyone give me a code to install The sims 2 fashion stuff?
All of the Sims2 games come with serial numbers for installation. Check either the back of the case or the back top of the instruction booklet for the serial number. If you still don't have one, you can contact EA Games, with proof of purchase and store receipt, and request a serial number.
Reply:The code is on the back of the booklet that comes with the game. If you bought it used contact the seller and ask them for the booklet. Otherwise you're out of luck.
Reply:the code should be on the back of the hand book that came with the game. If the game didn't come with a hand book then take back to the place you bought it from. I would also contact ea games. You will not get a code from the internet that will work because all cd's have a special code for it to run, if the code doesn't match on the cd it won't run. Your best bet is to take it back.
Reply:The game should come with a code, I know this as I have it myself. If you bought it from a known shop then take it back and ask to replace it, if you bought it from someone second hand etc, then it's your own fault.
How do I import GameShark code files to the VisualBoyAdvance?
How do I import GameShark code files to the VisualBoyAdvance?
Please, I need help.
How do I import GameShark code files to the VisualBoyAdvance?
open the game and on the top toolbar select cheats, go to cheat list and click on gameshark, enter the description and the cheat code then click ok, then you are ready to go!
Please, I need help.
How do I import GameShark code files to the VisualBoyAdvance?
open the game and on the top toolbar select cheats, go to cheat list and click on gameshark, enter the description and the cheat code then click ok, then you are ready to go!
What causes a 401 engine code on a 2001 PT Cruiser?
I found that a 401 engine code is cause by a expected change in the air fuel mixture not happening. What generally causes this engine warning and is it something I can fix. I can fix most anything that doesn't require specialty tools.
What causes a 401 engine code on a 2001 PT Cruiser?
p0401 is egr system failure. the egr vavlve most likely needs to be replaced. check the vacuum to the solenoid first. if it is ok, you need a new valve/solenoid assembly.
Reply:i have found that the most common cause of this code is a weak o2 sensor in the exhaust if you have not replaced this i would put a new one in they are in my opinion a maintenance item like spark plug look up near the manifold it kind of looks like a spark plug with a wire harness coming out of it.change this clear the code and see if it cures the problem if not you might have to take it to a garage to have it diagnosed good luck
flowers for algernon
What causes a 401 engine code on a 2001 PT Cruiser?
p0401 is egr system failure. the egr vavlve most likely needs to be replaced. check the vacuum to the solenoid first. if it is ok, you need a new valve/solenoid assembly.
Reply:i have found that the most common cause of this code is a weak o2 sensor in the exhaust if you have not replaced this i would put a new one in they are in my opinion a maintenance item like spark plug look up near the manifold it kind of looks like a spark plug with a wire harness coming out of it.change this clear the code and see if it cures the problem if not you might have to take it to a garage to have it diagnosed good luck
flowers for algernon
What is the code for Myspace that moves you tables to the left or the right?
I want to move my tables in my layout to the left but i can't find a code to do it. Can somebody give me the code or a link to wear i can find the code?
What is the code for Myspace that moves you tables to the left or the right?
For reliable myspace help sites with codes that actually work visit these sites:
MySpace Codes/Tutorials:
http://www.skem9.com/
http://www.joyboner.com/
http://bbzspace.com/
http://www.abrax.us/bbz/
http://groups.myspace.com/arrielwashere
http://groups.myspace.com/groupcoders
Reply:this switches the tables so that your profile is reversed. (about me, friends, comments, etc. will be on left of profile, picture, contact table and interests will be on right of profile)
Put this code in your about me.
%26lt;style%26gt;table {direction:rtl;}table table table {direction:ltr;}%26lt;/style%26gt;
What is the code for Myspace that moves you tables to the left or the right?
For reliable myspace help sites with codes that actually work visit these sites:
MySpace Codes/Tutorials:
http://www.skem9.com/
http://www.joyboner.com/
http://bbzspace.com/
http://www.abrax.us/bbz/
http://groups.myspace.com/arrielwashere
http://groups.myspace.com/groupcoders
Reply:this switches the tables so that your profile is reversed. (about me, friends, comments, etc. will be on left of profile, picture, contact table and interests will be on right of profile)
Put this code in your about me.
%26lt;style%26gt;table {direction:rtl;}table table table {direction:ltr;}%26lt;/style%26gt;
Does anyone have the promotional code from the coke can to purchase discount tickets for Universal Studios?
One of my kids cleaned the kitchen (imagine that?) and threw the can away I had been saving to purchase tickets! Does anyone have that promotional code or information on how to get discount tickets another way? Thanks.
Does anyone have the promotional code from the coke can to purchase discount tickets for Universal Studios?
My coke can reads "Go to mycokerewards.com and type 'Six Flags' in the search box then sign in to save on Regular admission to Six Flags Great Adventure or Hurricane Harbor.
Maybe you can try the same thing except type 'Universal Studios' or some variation of the name in the search box. Hope this is what you were looking for.
Does anyone have the promotional code from the coke can to purchase discount tickets for Universal Studios?
My coke can reads "Go to mycokerewards.com and type 'Six Flags' in the search box then sign in to save on Regular admission to Six Flags Great Adventure or Hurricane Harbor.
Maybe you can try the same thing except type 'Universal Studios' or some variation of the name in the search box. Hope this is what you were looking for.
Does anyone know where I can find assembly code to inteface a 16 key keypad to an 8051?
I'm trying to write assembly code to interface a 16 key keypad to an 8051 through a 922 encoder. If I could find some example code, I would be much better off.
Does anyone know where I can find assembly code to inteface a 16 key keypad to an 8051?
http://www.pjrc.com/tech/8051/
Does anyone know where I can find assembly code to inteface a 16 key keypad to an 8051?
http://www.pjrc.com/tech/8051/
What is the code for that music note symbol for myspace?
There are different codes for symbols for like my space like the ♥ the code is
%26amp; hearts ; (but without the spaces) and other symbols and so on. How do you make that like music not symbol? plz tell me the code! I've been dying to know!
What is the code for that music note symbol for myspace?
Here are other codes, in addition to the music notes:
http://www.windsor.igs.net/~phayes/WebSt...
Has a lot of symbols for you to use and the codes to make them.
Reply:Go to google and do a search for ALT codes, There are websites that will show you the codes for every possible symbol.
Ok that music note I just did is ALT+13 and ALT+14
☺☻♥♦♣♠•◘○◙♂♀♪
♫
Reply:while pressing alt type in 13
business cards
%26amp; hearts ; (but without the spaces) and other symbols and so on. How do you make that like music not symbol? plz tell me the code! I've been dying to know!
What is the code for that music note symbol for myspace?
Here are other codes, in addition to the music notes:
http://www.windsor.igs.net/~phayes/WebSt...
Has a lot of symbols for you to use and the codes to make them.
Reply:Go to google and do a search for ALT codes, There are websites that will show you the codes for every possible symbol.
Ok that music note I just did is ALT+13 and ALT+14
☺☻♥♦♣♠•◘○◙♂♀♪
♫
Reply:while pressing alt type in 13
business cards
How do I find these questions in the 2005 National Building Code of Canada binder?
What is the maximum length permissible for foundation walls with no crack control joints according to the National Building Code of Canada? Also, when crack control joints are required, what is the maximum spacing required?
How do I find these questions in the 2005 National Building Code of Canada binder?
I'm going to answer based on my knowledge of the international building code (paradoxically, this is a US standard, we're just uppity), the IBC doesn't list crack control joints, leaving it to the ACI, really crack control joint spacing depends on the shrinkage expected in the concrete, if you need it watertight, and other things, so the building code in the US doesn't set limits. You can get guidelines from ACI on crack control spacing, perhaps 20 feet to thirty feet being reasonably common (and this is not a completely blind guess, but I don't do a lot of long walls, so it has some grounding in reality but not an expert answer by any means), up to 100' if you really got specific on the concrete formulation and used special (expensive) concretes.
I would suspect that the NBC of Canada does the same thing, in other words, offers no advice and you'll have to go to the canadian equivalent to the ACI (the American Concrete Institute), who publishes ACI 318, the standard for building construction in concrete for the U.S.
If you are asking about residential construction, I would be surprised if many contractors put in crack control joints, preferring to pour it full length and let it crack, the cracks are not likely to be large and the homeowner can be left with the headache of sealing the crack in a year when the shrinkage finally stops and they notice water through the wall. Barring that, the International Residential Code might have some information but I doubt it. If I find anything more specific I'll post it.
Sorry I can't be more specific.
How do I find these questions in the 2005 National Building Code of Canada binder?
I'm going to answer based on my knowledge of the international building code (paradoxically, this is a US standard, we're just uppity), the IBC doesn't list crack control joints, leaving it to the ACI, really crack control joint spacing depends on the shrinkage expected in the concrete, if you need it watertight, and other things, so the building code in the US doesn't set limits. You can get guidelines from ACI on crack control spacing, perhaps 20 feet to thirty feet being reasonably common (and this is not a completely blind guess, but I don't do a lot of long walls, so it has some grounding in reality but not an expert answer by any means), up to 100' if you really got specific on the concrete formulation and used special (expensive) concretes.
I would suspect that the NBC of Canada does the same thing, in other words, offers no advice and you'll have to go to the canadian equivalent to the ACI (the American Concrete Institute), who publishes ACI 318, the standard for building construction in concrete for the U.S.
If you are asking about residential construction, I would be surprised if many contractors put in crack control joints, preferring to pour it full length and let it crack, the cracks are not likely to be large and the homeowner can be left with the headache of sealing the crack in a year when the shrinkage finally stops and they notice water through the wall. Barring that, the International Residential Code might have some information but I doubt it. If I find anything more specific I'll post it.
Sorry I can't be more specific.
What is the registration code for THE SIMS SUPERSTAR Somebody help me plz?
I need the registration code for The Sims Superstar because I lost my manual and my computer got cleaned. Not the online game.... The game you go to the store and buy.
What is the registration code for THE SIMS SUPERSTAR Somebody help me plz?
Each CD has its own code so you can't use someone else's.
If you don't have the manual or if it's not on the CD try calling the customer support. If you registered the game online they should have some kind of information for it.
Reply:It's on the back of the CD case that it came in.
Reply:there is more than one code for it. i lost mine too but you can go to the sims.com and there is a little button that you can click thats says like lost your code? or something like that.
Reply:you can go to www.google.com and searchy The sims Superstar Serial code
birthday cards
What is the registration code for THE SIMS SUPERSTAR Somebody help me plz?
Each CD has its own code so you can't use someone else's.
If you don't have the manual or if it's not on the CD try calling the customer support. If you registered the game online they should have some kind of information for it.
Reply:It's on the back of the CD case that it came in.
Reply:there is more than one code for it. i lost mine too but you can go to the sims.com and there is a little button that you can click thats says like lost your code? or something like that.
Reply:you can go to www.google.com and searchy The sims Superstar Serial code
birthday cards
How do I change the push button code on a door king 6002/6400 automatic gate opener?
my customer got a under ground automatic gate opener we need to change the code to lessen the amount of people who now know it , as construction has made it neccesary to release the code to others
so now he'd like to regain his security,
only we didnt get that information from the
installer thanks.
How do I change the push button code on a door king 6002/6400 automatic gate opener?
Here is tech support from DKS:
http://www.dkaccess.com/
Kabum
Reply:the keypad is by its self you gotta know the make and model of it to get the info on how to reset it
try this site see if it helps you
http://gatedepot.com/sales_keypads.html
they tell you how to reset the code on there
so now he'd like to regain his security,
only we didnt get that information from the
installer thanks.
How do I change the push button code on a door king 6002/6400 automatic gate opener?
Here is tech support from DKS:
http://www.dkaccess.com/
Kabum
Reply:the keypad is by its self you gotta know the make and model of it to get the info on how to reset it
try this site see if it helps you
http://gatedepot.com/sales_keypads.html
they tell you how to reset the code on there
What is the GameShark code for pokemon Sapphire to get shiny pokemon??
I really wan't shiny pokemon for my sapphire, but i can never find them, so i got a GameShark hoping it will have that code but it didn't. So can someone please tell me the gameshark code is for shiny pokemon please.
What is the GameShark code for pokemon Sapphire to get shiny pokemon??
must be on
928817F0298A
50F818720DD7
E005BA4B98A5
shiny pokemon
81FE44749C55
A0FA44FCCC7F
11B25A7BD975
56FC0D142272
D9A856E44D4C
What is the GameShark code for pokemon Sapphire to get shiny pokemon??
must be on
928817F0298A
50F818720DD7
E005BA4B98A5
shiny pokemon
81FE44749C55
A0FA44FCCC7F
11B25A7BD975
56FC0D142272
D9A856E44D4C
How do I make the angling furniture code in the sims 2 work when I have typed in the allow45degree.. code?
I typed in the code (boolProp allow45DegreeAngleOfRotation) press enter and I can't do anything with the furniture except twist it like usual.
How do I make the angling furniture code in the sims 2 work when I have typed in the allow45degree.. code?
Use the keys between M and the question mark
They look like this %26lt; %26gt; That'll spin your furniture around. :)
edit: the cheat is either true or false, you forgot to say true. It will NOT turn on til you tell it what to do. :)
boolProp allow45DegreeAngleOfRotation true
Reply:try going to cheatplanet.com they have all the cheats.
How do I make the angling furniture code in the sims 2 work when I have typed in the allow45degree.. code?
Use the keys between M and the question mark
They look like this %26lt; %26gt; That'll spin your furniture around. :)
edit: the cheat is either true or false, you forgot to say true. It will NOT turn on til you tell it what to do. :)
boolProp allow45DegreeAngleOfRotation true
Reply:try going to cheatplanet.com they have all the cheats.
What is the plant code for the Menu Foods plant in Pennsauken, NJ?
I am having a difficult time finding anything on the NJ plant code. I am aware that cans with the plant code 4197 are being recalled, but it is my understanding that is the code for the Kansas plant. Anyone know where to find a list of Menu Foods plant codes?
What is the plant code for the Menu Foods plant in Pennsauken, NJ?
Not sure if this is the NJ plant code, but Fancy Feast site lists 1798 as a plant code for recalled Mighty Dog pouches.
http://www.purina.com/company/press/2007...
Reply:I do not know the answer to that question but I do know that I have a dog AND cat that both died after eating food from 4583 which is another city and state from the two listed on the recall. My little white dog died a horrible death within less than14 hours. He had been a happy little dog jumping around waiting for breakfast and looking up at me waiting to be fed and within 14 hours he was dead. Draw your own conclusions.
Reply:Read this current article that came out today. The list is at the bottom. Maybe it will help. Best of luck! :)
http://news.yahoo.com/s/ap/20070323/ap_o...
sepal
What is the plant code for the Menu Foods plant in Pennsauken, NJ?
Not sure if this is the NJ plant code, but Fancy Feast site lists 1798 as a plant code for recalled Mighty Dog pouches.
http://www.purina.com/company/press/2007...
Reply:I do not know the answer to that question but I do know that I have a dog AND cat that both died after eating food from 4583 which is another city and state from the two listed on the recall. My little white dog died a horrible death within less than14 hours. He had been a happy little dog jumping around waiting for breakfast and looking up at me waiting to be fed and within 14 hours he was dead. Draw your own conclusions.
Reply:Read this current article that came out today. The list is at the bottom. Maybe it will help. Best of luck! :)
http://news.yahoo.com/s/ap/20070323/ap_o...
sepal
What is the cheat code for getting teen sims pregnant in the Sims 2?
Some people say it's impossible but it isn't. I've seen it with my own eyes but I don't know the cheat code.
What is the cheat code for getting teen sims pregnant in the Sims 2?
The games doesn't do this. There is a hack that does but it's a very large hack and not for the faint-hearted. You should read the instructions for it carefully. If you don't install it properly, it won't work and will possibly cause your game to become faulty (though the fix for this is to just delete it again).
Google for it - it will turn up. You should get it from the original site. DON'T download it from anywhere but it's own site (the other poster's link is not the site you are looking for). Other copies will be outdated and possibly buggy. Make sure you get the right version for your game.
Reply:i downloaded it from forumammo.com/cpg/displayimage.php?.com
Reply:Its not a cheat it is something you download on the net.
What is the cheat code for getting teen sims pregnant in the Sims 2?
The games doesn't do this. There is a hack that does but it's a very large hack and not for the faint-hearted. You should read the instructions for it carefully. If you don't install it properly, it won't work and will possibly cause your game to become faulty (though the fix for this is to just delete it again).
Google for it - it will turn up. You should get it from the original site. DON'T download it from anywhere but it's own site (the other poster's link is not the site you are looking for). Other copies will be outdated and possibly buggy. Make sure you get the right version for your game.
Reply:i downloaded it from forumammo.com/cpg/displayimage.php?.com
Reply:Its not a cheat it is something you download on the net.
What is the dress code for Life Uniform employees?
Hi, I was just wondering if anyone could tell me the dress code policy for employees that work for Life Uniform Companies. F.Y.I. Life Uniform is a retail store that specializes in uniforms such as nurse scrubs and pants. I just want to know what employees are expected to wear. Thanks for your answers.
What is the dress code for Life Uniform employees?
The employees at the Life Uniform I shop at always wear scrubs. :)
Reply:call and ask
What is the dress code for Life Uniform employees?
The employees at the Life Uniform I shop at always wear scrubs. :)
Reply:call and ask
What is the dress code for a Lord & Taylor sales associate?
What is the dress code for a Lord %26amp; Taylor sales associate?
Also, what is the starting pay for a L%26amp;T associate in NY state?
I will be hired into the women's clothing department, can i wear designer jeans like the ones i will be selling, or is it dress pants only?
Thanks.
What is the dress code for a Lord %26amp; Taylor sales associate?
The store should have specifics on what you can and cannot wear. I don't know what it is for that store, try asking the Hiring Manager or the General Manager.
Also, what is the starting pay for a L%26amp;T associate in NY state?
I will be hired into the women's clothing department, can i wear designer jeans like the ones i will be selling, or is it dress pants only?
Thanks.
What is the dress code for a Lord %26amp; Taylor sales associate?
The store should have specifics on what you can and cannot wear. I don't know what it is for that store, try asking the Hiring Manager or the General Manager.
How to get rid of the phone lock when you cant remember the pass code?
i accidently forgot my phone lock pass code such a stupid thing to do.Anyone please please tell me what i have to do. I tried all my pass codes and none of them worked any suggestions?
How to get rid of the phone lock when you cant remember the pass code?
If you look in the manual for your phone, there is a way to reset the phone, which sets the code as a factory default.
Of course, when you reset the phone using that method, you lose all the information that is on it, like saved numbers, messages, and other things, it will be back to how it was when you first got your phone.
Reply:ask your parents permission to use the phone.
printable cards
How to get rid of the phone lock when you cant remember the pass code?
If you look in the manual for your phone, there is a way to reset the phone, which sets the code as a factory default.
Of course, when you reset the phone using that method, you lose all the information that is on it, like saved numbers, messages, and other things, it will be back to how it was when you first got your phone.
Reply:ask your parents permission to use the phone.
printable cards
How does one make , code and test a java application?
I want to know how I can make a java program, code it and be able to show it on my computer.
A step by step way of doing it. I have problem using the NetBeans IDE to work with. I need your guidelines how to do it with the NetBeans or any other simple editor.
Thanks in advance for you solutions.
How does one make , code and test a java application?
Here is a simple Java Program. You can write it in any editor. I cannot give you exact instructions on using NetBeans, but you may have to create a Project, which is where all the files for one application are kept together.
I have not used NetBeans, as I find it too slow to start up.
Put this in a file named "HelloWorld.java"
public class HelloWorld {
System.out.println("Hello World!");
}
Thats it.
Then you have to compile the file HelloWord.java Once again, I cannot give you precise instructions for using NetBeans. If you install the Java SDK without NetBeans, then you should be able to compile from the command line.
To get the command line, in winXP it is called Command Prompt. In win98, it is called MS-DOS Prompt.
From the command line, navigate to the directory containing HelloWorld.java
Then type in 'javac HelloWorld.java'
This should compile to a HelloWorld.class file
To run this file, for testing etc, you type the command:
java HelloWorld
It should type out something like:
Hello World!
Apart from that, you may have to check the web site for NetBeans to see how it does these things.
If you cannot use Java on the command line, then check out the information about installing Java on the java web site.
Reply:netbean is an excellent software for beginners.
i can't really show you how to use it just play with it a little bit.
i figure it out by myself you can too.
A step by step way of doing it. I have problem using the NetBeans IDE to work with. I need your guidelines how to do it with the NetBeans or any other simple editor.
Thanks in advance for you solutions.
How does one make , code and test a java application?
Here is a simple Java Program. You can write it in any editor. I cannot give you exact instructions on using NetBeans, but you may have to create a Project, which is where all the files for one application are kept together.
I have not used NetBeans, as I find it too slow to start up.
Put this in a file named "HelloWorld.java"
public class HelloWorld {
System.out.println("Hello World!");
}
Thats it.
Then you have to compile the file HelloWord.java Once again, I cannot give you precise instructions for using NetBeans. If you install the Java SDK without NetBeans, then you should be able to compile from the command line.
To get the command line, in winXP it is called Command Prompt. In win98, it is called MS-DOS Prompt.
From the command line, navigate to the directory containing HelloWorld.java
Then type in 'javac HelloWorld.java'
This should compile to a HelloWorld.class file
To run this file, for testing etc, you type the command:
java HelloWorld
It should type out something like:
Hello World!
Apart from that, you may have to check the web site for NetBeans to see how it does these things.
If you cannot use Java on the command line, then check out the information about installing Java on the java web site.
Reply:netbean is an excellent software for beginners.
i can't really show you how to use it just play with it a little bit.
i figure it out by myself you can too.
What are the most profitable ways for a programmer to make money from open source code?
As a programmer, I am impressed by the quantity and quality of open source software products. A couple of the best ones I've personally used are: jEdit and FreeMind. I support the open source concept, but am concerned that it negatively impacts programmers' income potential. Becoming an open source consultant would probably be the best way of making a living from writing open source code. How else can a programmer make a living from open source code?
What are the most profitable ways for a programmer to make money from open source code?
The canonical way to earn money from open source is to offer customization and support. You provide the software as-is for free, and offer value-added materials like manuals, training, and custom modifications for a price. The theory is that once written, the code has no marginal cost, but the other products and services do.
The most common open-source license is GNU, and you can legally repackage and resell any code released under the GNU license provided you make the full source code available and release it under the same license -- which means that you have no recourse if someone else takes your distribution, repackages it, and redistributes it at a slightly lower price. Really, the place to make money is in customization and other consulting work, not from the software itself.
Reply:Another way is to let people download the program for a trial period and then when the trial is over give them a choice to either buy or to uninstall the application.
Reply:edit the programs, burn them to a cd, and sell them.
Try to sell over the internet - that would be a good place to start.
Or maybe on eBay.
It's all up to you.
What are the most profitable ways for a programmer to make money from open source code?
The canonical way to earn money from open source is to offer customization and support. You provide the software as-is for free, and offer value-added materials like manuals, training, and custom modifications for a price. The theory is that once written, the code has no marginal cost, but the other products and services do.
The most common open-source license is GNU, and you can legally repackage and resell any code released under the GNU license provided you make the full source code available and release it under the same license -- which means that you have no recourse if someone else takes your distribution, repackages it, and redistributes it at a slightly lower price. Really, the place to make money is in customization and other consulting work, not from the software itself.
Reply:Another way is to let people download the program for a trial period and then when the trial is over give them a choice to either buy or to uninstall the application.
Reply:edit the programs, burn them to a cd, and sell them.
Try to sell over the internet - that would be a good place to start.
Or maybe on eBay.
It's all up to you.
What is the federal code for Parsons the New School for Design?
I need the federal code for the college:
Parsons the New School for Design, but I can't find it!
Help, please?
Thanks in advance!
What is the federal code for Parsons the New School for Design?
# 002780
In the Financial Aid section...Student Services... Forms %26amp; Applications
Reply:The Federal Code is 002780.
If you mean "zip code," it is 10011.
Parsons the New School for Design, but I can't find it!
Help, please?
Thanks in advance!
What is the federal code for Parsons the New School for Design?
# 002780
In the Financial Aid section...Student Services... Forms %26amp; Applications
Reply:The Federal Code is 002780.
If you mean "zip code," it is 10011.
With Microsoft office, How many times after purchasing, can the key code be reinstalled ?
When you purchase a Microsoft Office Program, Does anyone know how many times that the key code can be used? I am not asking how many machines it can be installed on, but after removing the program from a machine how many more times can it be reinstalled? Thanks to all in advance!
With Microsoft office, How many times after purchasing, can the key code be reinstalled ?
infinite and beyond?
Legally speaking, one. But if you de-install first, you can keep moving it from computer to computer.
Although the online activation will fail after two different computers. Then you will need to call everytime afterwards. Take about 1 hour last time i did it.
Reply:Yes,,same system,,,for ever,
Reply:It should be unlimited, so long as it is reinstalled on the same machine.
Reply:as much as you want...
love song lyrics
With Microsoft office, How many times after purchasing, can the key code be reinstalled ?
infinite and beyond?
Legally speaking, one. But if you de-install first, you can keep moving it from computer to computer.
Although the online activation will fail after two different computers. Then you will need to call everytime afterwards. Take about 1 hour last time i did it.
Reply:Yes,,same system,,,for ever,
Reply:It should be unlimited, so long as it is reinstalled on the same machine.
Reply:as much as you want...
love song lyrics
How to develop a system of inquiry for a code of ethics in the workplace?
I am a college student studying business management. I need help in answering the followinf questions regarding bisnesss ethics:How to develop a system of inquiry to be used inevaluating decision-making, problem solving, and behavior in a business setting. this model should include a basic framework as wellas a discussion of why, how, when, and by whom itis used. Consider how you would implement the code, possible reactions to the code from employees, and the effect the code would have on the organization?
How to develop a system of inquiry for a code of ethics in the workplace?
Visit this site http://net-new.blogspot.com and search
How to develop a system of inquiry for a code of ethics in the workplace?
Visit this site http://net-new.blogspot.com and search
What is the cheat code for the sims 2 to make the teens grow up?
I know there is a cheat where it makes the kids grow up so you dont have to wait for the age clock. i want my teen to grow up! whats the code?
What is the cheat code for the sims 2 to make the teens grow up?
you're better off googling this - Yahoo! likes to delete questions that ask for codes. Good luck and I hope you find what you are looking for..
Reply:Using the AgeSimsCheat on in the cheat screen allows you to activate the SetAge interaction button for your sim.
What is the cheat code for the sims 2 to make the teens grow up?
you're better off googling this - Yahoo! likes to delete questions that ask for codes. Good luck and I hope you find what you are looking for..
Reply:Using the AgeSimsCheat on in the cheat screen allows you to activate the SetAge interaction button for your sim.
What is the area code to the address to 1023grandview in sioux city iowa?
What is the area code to the address to 1023 Grandview Street Sioux City,Iowa?
What is the area code to the address to 1023grandview in sioux city iowa?
If the asker was asking about telephone area codes, 712 is the area code.
Reply:Yahoo Community Guidelines clearly state that it is improper to post personally identifying information, such as private telephone numbers or residential home addresses, on this forum. You wouldn't want your home address plastered all over the Internet would you? As "Buck" stated, you can find this information at the USPS website. Please remove this question, and respect this party's privacy.
Reply:712
What is the area code to the address to 1023grandview in sioux city iowa?
If the asker was asking about telephone area codes, 712 is the area code.
Reply:Yahoo Community Guidelines clearly state that it is improper to post personally identifying information, such as private telephone numbers or residential home addresses, on this forum. You wouldn't want your home address plastered all over the Internet would you? As "Buck" stated, you can find this information at the USPS website. Please remove this question, and respect this party's privacy.
Reply:712
What is the DNA code of the bengal tiger?
I need the code in the ATGC format, example: humans are tgaccccaatacgcaaaattaaccccctaataaaattaat... please help!
What is the DNA code of the bengal tiger?
This is a portion of a sequence using Mitochondrial D loop analysis of "Big cats and their hybrid":
5 GCATCTGGTTCTTACTTCAGG 3 (forward)
5 ATTTTCAGTGTCTTGCTTTT 3 (reverse).
Reply:It took several years to get the genome for humans. The list would probably be several billion long and I doubt that anybody has the complete list.
Reply:Since that would be about 30 million base pairs, that might be a bit too large to fit in this answer space.
greeting cards
What is the DNA code of the bengal tiger?
This is a portion of a sequence using Mitochondrial D loop analysis of "Big cats and their hybrid":
5 GCATCTGGTTCTTACTTCAGG 3 (forward)
5 ATTTTCAGTGTCTTGCTTTT 3 (reverse).
Reply:It took several years to get the genome for humans. The list would probably be several billion long and I doubt that anybody has the complete list.
Reply:Since that would be about 30 million base pairs, that might be a bit too large to fit in this answer space.
greeting cards
Where do I find the key code or the original keyless entry code to reset my keyless code on an 01 Explorer?
I lost the keys and forgot the keyless entry code to my 2001 Explorer Sport Trac (had been parked for a while). Now where do I find the key code so I can have a new key cut by a dealer or find the code to reset my keyless entry (on the door)? Thanks!
Where do I find the key code or the original keyless entry code to reset my keyless code on an 01 Explorer?
it should be in the owners manual, but if not, it tells you were it is :)
Reply:on the back hatch there should be the code, or just bring to dealer and they will look it up
Reply:I hope you found your keys by now. Incase you did find them, I found a few sites that said different things about resetting the keycodes.... I have an 01 Explorer Sport, inside my owners manual there is a plastic card about the size of a credit card that lists it. ( I forgot my code once too, I stood there punching in codes for a little while and it eventually came back to me and I got it. You didnt say how long you have the truck, so I hope you did try and memorize it. I was also very nervous when I forgot it and I just took a deep breath to relax and, like I said before, I started punching in numbers that I remembered.
--------------------------------------...
Whew! I am debating if it would have been worth it to let the dealer get the code for $70? It took me about 2 1/2 hours but that was due largely because the instructions I found were not very accurate on where to locate the CSM (Computer Security Module). If I knew exactly where to start with, I could have completed the job in 20-30 minutes. Here is the shortcut for anybody else to follow:
It is located on the Passenger side on the post behind the rear door and underneath all the plastic trim. I is bolted to the side and is under the lower trim cover.
Step 1 - Pull the rubber door gasket loose from the bottom all around the rear of the door opening and about halfway across the top.
Step 2 - Rotate the two metal clips that are attached to the upper trim piece on the rear of the door opening.
Step 3 - Unsnap the rear clips of the upper trim piece (the one where the seat belt comes out of) by tugging on the rear edge. There are 3 clips in there in the rear.
Step 4 - Unsnap the last clip in the center up high.
Step 5 - Remove the trim piece by pulling the bottom of the piece outward and pulling downward. There is a metal "guide" in the top-front area just above the seat belt opening that you will need to watch.
Step 6 - Now remove the small metal clip that holds the bottom plastic trim piece to the edge of the door opening. It will be down by the bottom of the door opening.
Step 7 - Pull the top of the bottom plastic trim piece out as much as you can to see the CSM bolted to the wall behind it. The CSM will be the black box about 5" wide by 4" tall by 1" deep. You should wedge something in between the trim piece and the metal of the door edge to give you both hands free.
Step 8 - Now that you have both hands free, reach into the CSM and pull up on the bottom of the module to rotate the front up toward you a bit so you can see the label on the front. The 5 digit code will be the last 5 of the numbers underneath a bar code. The 5 digits are grouped out by themselves so you will recognize it.
Step 9 - Now before you put all this trim back, walk around to the driver's side door and try out the code to make sure it works.
Step 10 - Put it all back in reverse order. DONE!
**************************************...
Some models have the keycode behind the passenger headlight on the module (I'm saying this just incase, by dumb luck, your hood isn't locked)
You cannot change/reset the factory code but can program your own personal codes if you have the factory code {or your personal code}...here's how to do it:
1. Enter the factory-set {or personal} code (keypad will illuminate when pressed).
2. Press the 1/2 button within 5 seconds of Step 1
3. Enter your {new} personal 5-digit code. Enter each digit within 5 seconds of the previous one.
The manual states: Do not set a code that includs three of the same number or presents them in sequential order; these types of codes are easier to figure out. {It will accept them, however.}
Your personal code does not replace the factory code. You can use either to unlock the vehicle. If a second personal code is entered, the module will erase the first personal code in favor of the new code.
To exit, press 7/8 and 9/0 simultaneously or allow more than 5 seconds to elapse since a button press occured and the 5 digit keycode will be programmed.""
Reply:if you cant get inside call the manufacture on their toll free help line and give them the vin number and they can tell you every thing that you need to know about your explorer
Reply:It should be in your owners manual on a white plastic card. In absence of that, it's affixed to a decal on the RAP (remote anti-theft personality) module. It is located behind the trim panel that is behind your rear seats. To access the module requires removing the panel to get a clear view. There should be a black box, with two connectors to it, secured by two bolts. The five digit code will be on the label. You will have to get the dealer to obtain your key code information when you give them your VIN because you not only to have new keys cut, but they will need to be PROGRAMMED as well (your vehicle uses PATS keys). You might as well have them obtain your keyless entry code as well, while you're there. Sorry, but there's no other way around it.
Reply:Look in your owners manual or take it to the dealer and have them reset it.
Reply:try FORD ,COM they have alisted code search, or you main dealer will help . at a price maybe $35 its really just a pc that down loads the code,and have it changed to your birthday good luck
Reply:it should be in the owners manual or if you can get in touch of the manufactures and ask them
Where do I find the key code or the original keyless entry code to reset my keyless code on an 01 Explorer?
it should be in the owners manual, but if not, it tells you were it is :)
Reply:on the back hatch there should be the code, or just bring to dealer and they will look it up
Reply:I hope you found your keys by now. Incase you did find them, I found a few sites that said different things about resetting the keycodes.... I have an 01 Explorer Sport, inside my owners manual there is a plastic card about the size of a credit card that lists it. ( I forgot my code once too, I stood there punching in codes for a little while and it eventually came back to me and I got it. You didnt say how long you have the truck, so I hope you did try and memorize it. I was also very nervous when I forgot it and I just took a deep breath to relax and, like I said before, I started punching in numbers that I remembered.
--------------------------------------...
Whew! I am debating if it would have been worth it to let the dealer get the code for $70? It took me about 2 1/2 hours but that was due largely because the instructions I found were not very accurate on where to locate the CSM (Computer Security Module). If I knew exactly where to start with, I could have completed the job in 20-30 minutes. Here is the shortcut for anybody else to follow:
It is located on the Passenger side on the post behind the rear door and underneath all the plastic trim. I is bolted to the side and is under the lower trim cover.
Step 1 - Pull the rubber door gasket loose from the bottom all around the rear of the door opening and about halfway across the top.
Step 2 - Rotate the two metal clips that are attached to the upper trim piece on the rear of the door opening.
Step 3 - Unsnap the rear clips of the upper trim piece (the one where the seat belt comes out of) by tugging on the rear edge. There are 3 clips in there in the rear.
Step 4 - Unsnap the last clip in the center up high.
Step 5 - Remove the trim piece by pulling the bottom of the piece outward and pulling downward. There is a metal "guide" in the top-front area just above the seat belt opening that you will need to watch.
Step 6 - Now remove the small metal clip that holds the bottom plastic trim piece to the edge of the door opening. It will be down by the bottom of the door opening.
Step 7 - Pull the top of the bottom plastic trim piece out as much as you can to see the CSM bolted to the wall behind it. The CSM will be the black box about 5" wide by 4" tall by 1" deep. You should wedge something in between the trim piece and the metal of the door edge to give you both hands free.
Step 8 - Now that you have both hands free, reach into the CSM and pull up on the bottom of the module to rotate the front up toward you a bit so you can see the label on the front. The 5 digit code will be the last 5 of the numbers underneath a bar code. The 5 digits are grouped out by themselves so you will recognize it.
Step 9 - Now before you put all this trim back, walk around to the driver's side door and try out the code to make sure it works.
Step 10 - Put it all back in reverse order. DONE!
**************************************...
Some models have the keycode behind the passenger headlight on the module (I'm saying this just incase, by dumb luck, your hood isn't locked)
You cannot change/reset the factory code but can program your own personal codes if you have the factory code {or your personal code}...here's how to do it:
1. Enter the factory-set {or personal} code (keypad will illuminate when pressed).
2. Press the 1/2 button within 5 seconds of Step 1
3. Enter your {new} personal 5-digit code. Enter each digit within 5 seconds of the previous one.
The manual states: Do not set a code that includs three of the same number or presents them in sequential order; these types of codes are easier to figure out. {It will accept them, however.}
Your personal code does not replace the factory code. You can use either to unlock the vehicle. If a second personal code is entered, the module will erase the first personal code in favor of the new code.
To exit, press 7/8 and 9/0 simultaneously or allow more than 5 seconds to elapse since a button press occured and the 5 digit keycode will be programmed.""
Reply:if you cant get inside call the manufacture on their toll free help line and give them the vin number and they can tell you every thing that you need to know about your explorer
Reply:It should be in your owners manual on a white plastic card. In absence of that, it's affixed to a decal on the RAP (remote anti-theft personality) module. It is located behind the trim panel that is behind your rear seats. To access the module requires removing the panel to get a clear view. There should be a black box, with two connectors to it, secured by two bolts. The five digit code will be on the label. You will have to get the dealer to obtain your key code information when you give them your VIN because you not only to have new keys cut, but they will need to be PROGRAMMED as well (your vehicle uses PATS keys). You might as well have them obtain your keyless entry code as well, while you're there. Sorry, but there's no other way around it.
Reply:Look in your owners manual or take it to the dealer and have them reset it.
Reply:try FORD ,COM they have alisted code search, or you main dealer will help . at a price maybe $35 its really just a pc that down loads the code,and have it changed to your birthday good luck
Reply:it should be in the owners manual or if you can get in touch of the manufactures and ask them
Is there a myspace code that can take off the links on myspace?
Like when you have a picture from photobucket on your myspace profile is there a code to keep it from going to photobucket when you click on that picture? If so what is it?
Is there a myspace code that can take off the links on myspace?
Instead of using the html code copy and paste the direct link code here
%26lt;img src="DIRECT LINK"%26gt;
If you have any questions in the future check out the tutorials at http://www.OurAwesomeWorld.com
Reply:When you choose your picture on photobucket, copy the Direct Link, or url, and put it into this code:
%26lt;img src="URL HERE"%26gt;
When you directly copy the HTML tag, they add a link to the picture's code, which can be very annoying.
Is there a myspace code that can take off the links on myspace?
Instead of using the html code copy and paste the direct link code here
%26lt;img src="DIRECT LINK"%26gt;
If you have any questions in the future check out the tutorials at http://www.OurAwesomeWorld.com
Reply:When you choose your picture on photobucket, copy the Direct Link, or url, and put it into this code:
%26lt;img src="URL HERE"%26gt;
When you directly copy the HTML tag, they add a link to the picture's code, which can be very annoying.
What is the best web building program without knowing the code?
What is the best web building program without knowing the code?
I've tried Web Easy Professional, WYCIWYG 5.0, Web Studio 4.0, joomla and some other, but they all are missing some features, like drop-down menu or you cannot stratch the page depending on the screen size and some others.
What is the best web building program without knowing the code?
I'd say go with Microsoft Frontpage, http://microsoft.com/frontpage/ but I really encourage you to learn the basics as they will come in handy when troubleshooting your web site.
Learn HTML and CSS from http://reference.sitepoint.com/ -- This reference is an updated version of the W3C schools tutorials.
Good luck.
Reply:Hands down
Yahoo's SiteBuilder.
http://geocities.yahoo.com/
I've tried Web Easy Professional, WYCIWYG 5.0, Web Studio 4.0, joomla and some other, but they all are missing some features, like drop-down menu or you cannot stratch the page depending on the screen size and some others.
What is the best web building program without knowing the code?
I'd say go with Microsoft Frontpage, http://microsoft.com/frontpage/ but I really encourage you to learn the basics as they will come in handy when troubleshooting your web site.
Learn HTML and CSS from http://reference.sitepoint.com/ -- This reference is an updated version of the W3C schools tutorials.
Good luck.
Reply:Hands down
Yahoo's SiteBuilder.
http://geocities.yahoo.com/
How do you disable a layout code to dispay it on a layout site for people to copy?
I recently made a layout site on myspace and I am now ready to post the layouts. I want the code for the layout in a scroll box in the layout preview but I am unsure of how to disable the HTML so the code itself shows up in the scrollbox for people to copy. Any Help?
How do you disable a layout code to dispay it on a layout site for people to copy?
make a text area:
%26lt;textarea rows="13" cols="110"%26gt;
your stuff
%26lt;/textarea%26gt;
look at the source code on my page
http://live-vegas-chat.com/add-chat-to-m...
flower arranging
How do you disable a layout code to dispay it on a layout site for people to copy?
make a text area:
%26lt;textarea rows="13" cols="110"%26gt;
your stuff
%26lt;/textarea%26gt;
look at the source code on my page
http://live-vegas-chat.com/add-chat-to-m...
flower arranging
How do you code a myspace layout without using another site's layout generators?
I want to start a site, and I want to know how to actually code a layout without using one of those layout generators or makers.
How do you code a myspace layout without using another site's layout generators?
so what you are saying is that you want to learn how to write css code?
start here
http://www.w3schools.com/css/default.asp
good luck!
Reply:If you know a lot about HTML you can do what I do. A lot of people use a layout code and change the background image and stuff. If you know a lot about HTML but can't make a code from scratch, I just use a layout code and edit it (tables, colors, background, etc.) to what I'd like it to be.
Reply:i dint know
How do you code a myspace layout without using another site's layout generators?
so what you are saying is that you want to learn how to write css code?
start here
http://www.w3schools.com/css/default.asp
good luck!
Reply:If you know a lot about HTML you can do what I do. A lot of people use a layout code and change the background image and stuff. If you know a lot about HTML but can't make a code from scratch, I just use a layout code and edit it (tables, colors, background, etc.) to what I'd like it to be.
Reply:i dint know
How do i get my support code to stay in a box for others to use?
i just want to put my affie and support codes on my page,but i dont know how to do this without the picture showing up,without the code to copy
How do i get my support code to stay in a box for others to use?
%26lt;textarea%26gt; CODE HERE %26lt;/textarea%26gt;
Reply:that works! i used it too! hope ya don t mind!! Report It
How do i get my support code to stay in a box for others to use?
%26lt;textarea%26gt; CODE HERE %26lt;/textarea%26gt;
Reply:that works! i used it too! hope ya don t mind!! Report It
What is the secret word for the zoey one o win sweepstakes for fridays code?
What is the two secret words for the zoey one o win sweepstakes for fridays code?
What is the secret word for the zoey one o win sweepstakes for fridays code?
they havent announced them yet i dont think
Reply:jetx
Reply:Jet-X
Reply:rock hardcore
Reply:jetx
What is the secret word for the zoey one o win sweepstakes for fridays code?
they havent announced them yet i dont think
Reply:jetx
Reply:Jet-X
Reply:rock hardcore
Reply:jetx
How do you unlock a sprint phone i don't have a lock code for?
Somebody gave me a sprint phone and he didn't know the unlock code, and it's not the factory code either. How do I get pass that, what do I do?
How do you unlock a sprint phone i don't have a lock code for?
Take it to a service and repair sprint store and they can reset it for you.
flower arrangement
How do you unlock a sprint phone i don't have a lock code for?
Take it to a service and repair sprint store and they can reset it for you.
flower arrangement
What impact did code and encryption have on the lives of people during world war one?
i need to know. please. i'm doing a project and my parnter didnt do their half of the work so now i have to do the other half and i need help answering these questions. pleasee help.
also how does code and encryption connect with today.
what connections can be made?
pleaseeee help
thank you
What impact did code and encryption have on the lives of people during world war one?
The biggest impact was that insufficiently secure German codes led to America joining the war.
The "Zimmerman telegram" to Mexico offered them large chunks of the southern USA if they would declare war. Germany thought that if the USA had to fight on a southern land front, plus suffer unrestricted submarine attacks on its east coast shipping, it would soon have to agree to peace terms. Britain intercepted and decoded the telegram, it was published in the USA, and when Zimmerman in Berlin said "Yes, I wrote it", it was enough for the US Congress to declare war a few days later.
Modern computer-based encryption techniques are unrelated to those of WWI. However, general principles about code systems management still apply, and always will.
Reply:The impact was huge. Each nation encoded their messages, intercepted their enemies' messages (and their friends' as well), and tried to break their codes. The Allies succeeded in breaking several German Army codes in WWI, and captured a codebook from a sunken U-boat to give them some Navy codes as well.
The British did not use codes over their frontline field telephones, which employed 'ground return' circuits and were capable of being picked up by the enemy. After one disastrous attack on the Somme, they found a complete copy of their attack plan in a captured German bunker!
The subject is a large one, difficult to summarize in one brief message. I recommend doing some reading.
Reply:you use it every day when you are dealing with your own finances, work related technology and even daily computing...either on Internet or work network...it keeps phone lines working ,...it keeps the neighbor from having the same garage door opener code as you...it keeps burglars from getting into your home.
Code and encryption was the way information was moved between allies and enemies during the war. if you could intercept a coded message and break it you had a distinct advantage over the enemy or you could prepare for a devastating assault that would otherwise kill hundreds of people.
that is it in a nutshell
also how does code and encryption connect with today.
what connections can be made?
pleaseeee help
thank you
What impact did code and encryption have on the lives of people during world war one?
The biggest impact was that insufficiently secure German codes led to America joining the war.
The "Zimmerman telegram" to Mexico offered them large chunks of the southern USA if they would declare war. Germany thought that if the USA had to fight on a southern land front, plus suffer unrestricted submarine attacks on its east coast shipping, it would soon have to agree to peace terms. Britain intercepted and decoded the telegram, it was published in the USA, and when Zimmerman in Berlin said "Yes, I wrote it", it was enough for the US Congress to declare war a few days later.
Modern computer-based encryption techniques are unrelated to those of WWI. However, general principles about code systems management still apply, and always will.
Reply:The impact was huge. Each nation encoded their messages, intercepted their enemies' messages (and their friends' as well), and tried to break their codes. The Allies succeeded in breaking several German Army codes in WWI, and captured a codebook from a sunken U-boat to give them some Navy codes as well.
The British did not use codes over their frontline field telephones, which employed 'ground return' circuits and were capable of being picked up by the enemy. After one disastrous attack on the Somme, they found a complete copy of their attack plan in a captured German bunker!
The subject is a large one, difficult to summarize in one brief message. I recommend doing some reading.
Reply:you use it every day when you are dealing with your own finances, work related technology and even daily computing...either on Internet or work network...it keeps phone lines working ,...it keeps the neighbor from having the same garage door opener code as you...it keeps burglars from getting into your home.
Code and encryption was the way information was moved between allies and enemies during the war. if you could intercept a coded message and break it you had a distinct advantage over the enemy or you could prepare for a devastating assault that would otherwise kill hundreds of people.
that is it in a nutshell
Subscribe to:
Posts (Atom)